Incidental Mutation 'R3832:Trim47'
ID274077
Institutional Source Beutler Lab
Gene Symbol Trim47
Ensembl Gene ENSMUSG00000020773
Gene Nametripartite motif-containing 47
Synonyms
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116105752-116127210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116107957 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 279 (T279A)
Ref Sequence ENSEMBL: ENSMUSP00000102049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021120] [ENSMUST00000106441]
Predicted Effect probably benign
Transcript: ENSMUST00000021120
AA Change: T279A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021120
Gene: ENSMUSG00000020773
AA Change: T279A

DomainStartEndE-ValueType
RING 9 57 3.14e-11 SMART
low complexity region 101 122 N/A INTRINSIC
BBOX 128 177 8.32e0 SMART
BBOX 181 221 1.76e-5 SMART
low complexity region 337 349 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
PRY 431 482 1.4e-2 SMART
Blast:SPRY 483 632 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106441
AA Change: T279A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102049
Gene: ENSMUSG00000020773
AA Change: T279A

DomainStartEndE-ValueType
RING 9 57 3.14e-11 SMART
low complexity region 101 122 N/A INTRINSIC
BBOX 128 177 8.32e0 SMART
BBOX 181 221 1.76e-5 SMART
low complexity region 337 349 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
PRY 430 481 1.4e-2 SMART
Pfam:SPRY 482 579 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149957
Meta Mutation Damage Score 0.0404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Trim47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trim47 APN 11 116106194 missense probably damaging 1.00
IGL02040:Trim47 APN 11 116107908 missense probably damaging 1.00
IGL02419:Trim47 APN 11 116106201 missense probably damaging 1.00
IGL03329:Trim47 APN 11 116106428 missense probably damaging 1.00
trix UTSW 11 116107957 missense probably benign
R0190:Trim47 UTSW 11 116106227 missense probably damaging 1.00
R0379:Trim47 UTSW 11 116106518 missense probably damaging 1.00
R0523:Trim47 UTSW 11 116107890 missense probably damaging 1.00
R0671:Trim47 UTSW 11 116108352 missense probably benign
R1730:Trim47 UTSW 11 116106038 missense probably damaging 1.00
R1778:Trim47 UTSW 11 116109820 missense probably damaging 1.00
R1862:Trim47 UTSW 11 116106137 missense probably damaging 1.00
R1901:Trim47 UTSW 11 116107779 missense probably damaging 1.00
R2054:Trim47 UTSW 11 116108283 missense probably benign 0.43
R2081:Trim47 UTSW 11 116106413 missense probably damaging 1.00
R2099:Trim47 UTSW 11 116106344 missense probably damaging 1.00
R4948:Trim47 UTSW 11 116106092 missense probably damaging 1.00
R5097:Trim47 UTSW 11 116106434 missense probably benign 0.38
R5148:Trim47 UTSW 11 116107852 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGCTGACTGAATCCGCCTC -3'
(R):5'- ACAAGCTCTCACTGTGGTG -3'

Sequencing Primer
(F):5'- TGACTGAATCCGCCTCTGGAAC -3'
(R):5'- AAGCAGGAACACCTTGTTTCCTG -3'
Posted On2015-04-02