Incidental Mutation 'R3832:Klhl28'
ID274078
Institutional Source Beutler Lab
Gene Symbol Klhl28
Ensembl Gene ENSMUSG00000020948
Gene Namekelch-like 28
SynonymsBtbd5, 4122402F11Rik, 2810440N09Rik, 4931401E10Rik
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64938833-64965534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64951421 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 433 (G433V)
Ref Sequence ENSEMBL: ENSMUSP00000152602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021331] [ENSMUST00000222508]
Predicted Effect probably damaging
Transcript: ENSMUST00000021331
AA Change: G433V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021331
Gene: ENSMUSG00000020948
AA Change: G433V

DomainStartEndE-ValueType
BTB 35 132 3.55e-30 SMART
BACK 137 239 1.83e-36 SMART
Kelch 284 331 3.52e-4 SMART
Kelch 332 386 4.23e-7 SMART
Kelch 387 433 1.99e-12 SMART
Kelch 434 479 1.64e-13 SMART
Kelch 480 526 5.12e-15 SMART
Kelch 527 571 5.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221957
Predicted Effect probably damaging
Transcript: ENSMUST00000222508
AA Change: G433V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Klhl28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Klhl28 APN 12 64950066 missense probably damaging 1.00
IGL03059:Klhl28 APN 12 64951566 missense probably benign 0.00
IGL03246:Klhl28 APN 12 64957286 missense probably benign
R0014:Klhl28 UTSW 12 64957302 missense probably benign 0.06
R0607:Klhl28 UTSW 12 64951755 missense probably damaging 1.00
R0975:Klhl28 UTSW 12 64951688 missense possibly damaging 0.67
R1134:Klhl28 UTSW 12 64951617 missense probably benign 0.01
R1480:Klhl28 UTSW 12 64957221 missense probably damaging 1.00
R1675:Klhl28 UTSW 12 64951819 missense probably damaging 1.00
R2064:Klhl28 UTSW 12 64943472 missense probably benign 0.05
R3896:Klhl28 UTSW 12 64957559 missense probably damaging 1.00
R4327:Klhl28 UTSW 12 64950178 missense probably damaging 1.00
R4612:Klhl28 UTSW 12 64957260 missense probably damaging 0.99
R4817:Klhl28 UTSW 12 64957269 missense probably benign 0.00
R4872:Klhl28 UTSW 12 64957122 missense possibly damaging 0.94
R5007:Klhl28 UTSW 12 64957227 missense probably damaging 0.98
R5008:Klhl28 UTSW 12 64957227 missense probably damaging 0.98
R5010:Klhl28 UTSW 12 64957227 missense probably damaging 0.98
R5068:Klhl28 UTSW 12 64957712 missense probably benign 0.10
R5070:Klhl28 UTSW 12 64957712 missense probably benign 0.10
R6666:Klhl28 UTSW 12 64943527 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCAGTCTAAATCCCCAAATACTTGTC -3'
(R):5'- ACCTGGACTTCTCTCGAGAG -3'

Sequencing Primer
(F):5'- GCTTCTGTAGATATCTACAATC -3'
(R):5'- AACGAGAGCCGGAGTACTCTC -3'
Posted On2015-04-02