Incidental Mutation 'R3812:Vmn1r170'
ID274102
Institutional Source Beutler Lab
Gene Symbol Vmn1r170
Ensembl Gene ENSMUSG00000094187
Gene Namevomeronasal 1 receptor 170
SynonymsGm5999
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23606175-23607089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23606292 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 40 (S40P)
Ref Sequence ENSEMBL: ENSMUSP00000127655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170166]
Predicted Effect probably damaging
Transcript: ENSMUST00000170166
AA Change: S40P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127655
Gene: ENSMUSG00000094187
AA Change: S40P

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 1.8e-13 PFAM
Pfam:7tm_1 30 287 3.6e-6 PFAM
Pfam:V1R 42 295 1.4e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Vmn1r170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Vmn1r170 APN 7 23606913 missense probably damaging 1.00
IGL02150:Vmn1r170 APN 7 23607040 nonsense probably null
IGL02216:Vmn1r170 APN 7 23606490 missense probably damaging 1.00
IGL02749:Vmn1r170 APN 7 23606291 missense probably benign 0.00
IGL02807:Vmn1r170 APN 7 23606335 missense probably damaging 1.00
IGL02828:Vmn1r170 APN 7 23606518 missense probably damaging 0.99
IGL02971:Vmn1r170 APN 7 23606334 missense possibly damaging 0.81
IGL03073:Vmn1r170 APN 7 23606848 missense probably damaging 1.00
IGL03151:Vmn1r170 APN 7 23606577 missense probably benign 0.35
R0079:Vmn1r170 UTSW 7 23606310 missense possibly damaging 0.95
R0266:Vmn1r170 UTSW 7 23606481 missense probably benign 0.00
R0980:Vmn1r170 UTSW 7 23606334 missense possibly damaging 0.81
R1345:Vmn1r170 UTSW 7 23606362 missense probably benign 0.00
R1620:Vmn1r170 UTSW 7 23606329 missense probably benign 0.30
R1713:Vmn1r170 UTSW 7 23606863 missense probably benign 0.30
R1745:Vmn1r170 UTSW 7 23606334 missense probably damaging 0.98
R1974:Vmn1r170 UTSW 7 23606481 missense probably benign 0.00
R2163:Vmn1r170 UTSW 7 23607037 missense probably damaging 1.00
R4583:Vmn1r170 UTSW 7 23606662 missense probably benign 0.25
R5309:Vmn1r170 UTSW 7 23606455 missense probably damaging 0.97
R5378:Vmn1r170 UTSW 7 23606538 missense probably benign 0.00
R5379:Vmn1r170 UTSW 7 23606629 missense possibly damaging 0.81
R5661:Vmn1r170 UTSW 7 23606806 missense possibly damaging 0.82
R5673:Vmn1r170 UTSW 7 23606205 missense possibly damaging 0.58
R6181:Vmn1r170 UTSW 7 23606267 missense probably damaging 0.98
R6192:Vmn1r170 UTSW 7 23606509 missense probably damaging 1.00
R7467:Vmn1r170 UTSW 7 23606895 missense not run
R7667:Vmn1r170 UTSW 7 23607048 missense probably damaging 1.00
X0060:Vmn1r170 UTSW 7 23606943 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGATAAAGTAGAGCTGCCCTTCG -3'
(R):5'- TTCGAGCCACCAGCCAAATG -3'

Sequencing Primer
(F):5'- CCTTCGTGGGGAAAAATGTCTTC -3'
(R):5'- GCCAAATGAAGTACCCAAGTTTAC -3'
Posted On2015-04-02