Incidental Mutation 'R3812:Fbxw28'
ID274106
Institutional Source Beutler Lab
Gene Symbol Fbxw28
Ensembl Gene ENSMUSG00000054087
Gene NameF-box and WD-40 domain protein 28
SynonymsGm9337
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109322886-109339659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109338530 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 53 (C53F)
Ref Sequence ENSEMBL: ENSMUSP00000143361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112039] [ENSMUST00000112040] [ENSMUST00000196351] [ENSMUST00000200156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112039
AA Change: C53F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107670
Gene: ENSMUSG00000054087
AA Change: C53F

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112040
AA Change: C53F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107671
Gene: ENSMUSG00000054087
AA Change: C53F

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000196351
AA Change: C53F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143357
Gene: ENSMUSG00000054087
AA Change: C53F

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1aym1_ 54 102 2e-3 SMART
Blast:WD40 172 211 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000200156
AA Change: C53F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143361
Gene: ENSMUSG00000054087
AA Change: C53F

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1tbga_ 127 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Meta Mutation Damage Score 0.0811 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Fbxw28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Fbxw28 APN 9 109328325 missense probably benign 0.05
IGL02080:Fbxw28 APN 9 109339573 missense probably damaging 1.00
IGL02313:Fbxw28 APN 9 109337352 missense possibly damaging 0.76
R0029:Fbxw28 UTSW 9 109328289 missense probably damaging 1.00
R0038:Fbxw28 UTSW 9 109338540 missense probably damaging 1.00
R0058:Fbxw28 UTSW 9 109328211 missense probably benign 0.22
R1288:Fbxw28 UTSW 9 109337293 missense probably damaging 0.97
R1898:Fbxw28 UTSW 9 109323384 missense probably benign 0.32
R2065:Fbxw28 UTSW 9 109328224 missense probably benign 0.03
R2117:Fbxw28 UTSW 9 109330917 missense probably benign 0.04
R3410:Fbxw28 UTSW 9 109338404 missense possibly damaging 0.55
R4400:Fbxw28 UTSW 9 109328310 missense probably damaging 1.00
R4840:Fbxw28 UTSW 9 109339534 missense probably null 1.00
R4899:Fbxw28 UTSW 9 109330853 missense probably damaging 0.99
R5129:Fbxw28 UTSW 9 109326603 missense probably damaging 1.00
R5613:Fbxw28 UTSW 9 109338533 missense probably benign 0.02
R5777:Fbxw28 UTSW 9 109338536 missense probably damaging 0.98
R6029:Fbxw28 UTSW 9 109329425 missense probably damaging 1.00
R6235:Fbxw28 UTSW 9 109326190 missense probably damaging 1.00
R6367:Fbxw28 UTSW 9 109339531 critical splice donor site probably null
R6820:Fbxw28 UTSW 9 109338425 missense probably damaging 1.00
R6968:Fbxw28 UTSW 9 109330788 missense probably benign 0.00
R7763:Fbxw28 UTSW 9 109326633 missense probably damaging 0.96
RF024:Fbxw28 UTSW 9 109338526 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAGTGGGTGTCTCTTCTAG -3'
(R):5'- CAAGCAGTGATGTCCTGTGG -3'

Sequencing Primer
(F):5'- GGTGTCTCTTCTAGAGTACCCAAG -3'
(R):5'- CAGTGATGTCCTGTGGAGGTAAG -3'
Posted On2015-04-02