Incidental Mutation 'R3812:Metap2'
ID274107
Institutional Source Beutler Lab
Gene Symbol Metap2
Ensembl Gene ENSMUSG00000036112
Gene Namemethionine aminopeptidase 2
Synonymsp67, 4930584B20Rik, A930035J23Rik, eIF-2-associated p67
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93858489-93897093 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93870164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 252 (L252*)
Ref Sequence ENSEMBL: ENSMUSP00000138083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047910] [ENSMUST00000180688] [ENSMUST00000180840] [ENSMUST00000181091] [ENSMUST00000181217] [ENSMUST00000181470]
Predicted Effect probably null
Transcript: ENSMUST00000047910
AA Change: L242*
SMART Domains Protein: ENSMUSP00000048285
Gene: ENSMUSG00000036112
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 1.2e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180375
AA Change: L215*
Predicted Effect probably null
Transcript: ENSMUST00000180392
AA Change: L99*
Predicted Effect probably benign
Transcript: ENSMUST00000180688
SMART Domains Protein: ENSMUSP00000137652
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 76 107 N/A INTRINSIC
Pfam:Peptidase_M24 166 233 2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180840
AA Change: L242*
SMART Domains Protein: ENSMUSP00000138006
Gene: ENSMUSG00000036112
AA Change: L242*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 2.8e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181091
AA Change: L219*
SMART Domains Protein: ENSMUSP00000137904
Gene: ENSMUSG00000036112
AA Change: L219*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 144 443 2.2e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181217
AA Change: L252*
SMART Domains Protein: ENSMUSP00000138083
Gene: ENSMUSG00000036112
AA Change: L252*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 177 476 2.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181442
Predicted Effect probably benign
Transcript: ENSMUST00000181470
SMART Domains Protein: ENSMUSP00000138050
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
Pfam:Peptidase_M24 1 97 6.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216232
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methionyl aminopeptidase family. The encoded protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent proteins. Increased expression of this gene is associated with various forms of cancer, and the anti-cancer drugs fumagillin and ovalicin inhibit the protein by irreversibly binding to its active site. Inhibitors of this gene have also been shown to be effective for the treatment of obesity. A pseudogene of this gene is located on chromosome 2. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E8.5, smaller size, failure to gastrulate, reduced cell proliferation and absence of a distinct mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Metap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Metap2 APN 10 93871478 splice site probably benign
IGL02553:Metap2 APN 10 93865449 missense probably damaging 1.00
R0212:Metap2 UTSW 10 93861380 missense probably damaging 1.00
R0749:Metap2 UTSW 10 93879567 missense probably benign 0.43
R1183:Metap2 UTSW 10 93870184 missense probably damaging 1.00
R1459:Metap2 UTSW 10 93868949 missense probably damaging 1.00
R1468:Metap2 UTSW 10 93871483 splice site probably null
R1468:Metap2 UTSW 10 93871483 splice site probably null
R1646:Metap2 UTSW 10 93870197 missense probably damaging 1.00
R3810:Metap2 UTSW 10 93870164 nonsense probably null
R3811:Metap2 UTSW 10 93870164 nonsense probably null
R4174:Metap2 UTSW 10 93879565 missense possibly damaging 0.68
R4801:Metap2 UTSW 10 93868895 missense probably damaging 1.00
R4802:Metap2 UTSW 10 93868895 missense probably damaging 1.00
R4983:Metap2 UTSW 10 93889600 missense possibly damaging 0.86
R5030:Metap2 UTSW 10 93879677 splice site probably null
R5276:Metap2 UTSW 10 93868922 missense possibly damaging 0.93
R5276:Metap2 UTSW 10 93868932 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCAGTACAGCTTTAGAGAAGG -3'
(R):5'- TGAGCTCCGCATTCAGAAAG -3'

Sequencing Primer
(F):5'- TACAGCTTTAGAGAAGGAGCCAAG -3'
(R):5'- TGAGCTCCGCATTCAGAAAGTACTC -3'
Posted On2015-04-02