Incidental Mutation 'R3812:Polm'
ID274110
Institutional Source Beutler Lab
Gene Symbol Polm
Ensembl Gene ENSMUSG00000020474
Gene Namepolymerase (DNA directed), mu
SynonymsTdt-N, B230309I03Rik
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5827860-5838016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5829512 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 429 (F429L)
Ref Sequence ENSEMBL: ENSMUSP00000020767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020767] [ENSMUST00000109837]
PDB Structure
Polymerase mu in ternary complex with gapped 11mer DNA duplex and bound incoming nucleotide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020767
AA Change: F429L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020767
Gene: ENSMUSG00000020474
AA Change: F429L

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
PDB:2HTF|A 27 124 2e-42 PDB
POLXc 150 495 1.78e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109837
AA Change: F429L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105463
Gene: ENSMUSG00000020474
AA Change: F429L

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Blast:BRCT 27 112 1e-45 BLAST
PDB:2HTF|A 27 124 4e-42 PDB
POLXc 150 500 8.68e-78 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143478
Meta Mutation Damage Score 0.1965 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. However, B cell maturation and proliferation is abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Polm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Polm APN 11 5830137 missense probably benign 0.00
gott UTSW 11 5829512 missense possibly damaging 0.46
lobet UTSW 11 5829491 missense probably damaging 1.00
IGL02988:Polm UTSW 11 5836343 missense probably benign 0.02
R0626:Polm UTSW 11 5836207 missense probably damaging 0.97
R0736:Polm UTSW 11 5835495 missense possibly damaging 0.94
R1723:Polm UTSW 11 5834776 missense probably benign 0.04
R1893:Polm UTSW 11 5835574 missense possibly damaging 0.65
R2473:Polm UTSW 11 5829881 missense possibly damaging 0.94
R4676:Polm UTSW 11 5835749 nonsense probably null
R4705:Polm UTSW 11 5837663 missense possibly damaging 0.66
R4988:Polm UTSW 11 5837618 missense probably damaging 0.98
R5276:Polm UTSW 11 5829393 missense probably benign 0.16
R6401:Polm UTSW 11 5829491 missense probably damaging 1.00
R6783:Polm UTSW 11 5835534 missense probably damaging 1.00
X0018:Polm UTSW 11 5830158 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGATCAAACAGCCCATGG -3'
(R):5'- TCCTGTATCACCAGTACCACCG -3'

Sequencing Primer
(F):5'- GCTTCCTTTAGCAGGGTT -3'
(R):5'- GTACCACCGCAGCCATTTG -3'
Posted On2015-04-02