Incidental Mutation 'R3812:Txndc5'
ID274112
Institutional Source Beutler Lab
Gene Symbol Txndc5
Ensembl Gene ENSMUSG00000038991
Gene Namethioredoxin domain containing 5
SynonymsPC-TRP, ERp46
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38500079-38528824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38523405 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 99 (K99E)
Ref Sequence ENSEMBL: ENSMUSP00000041839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035988] [ENSMUST00000160653] [ENSMUST00000162075]
Predicted Effect probably benign
Transcript: ENSMUST00000035988
AA Change: K99E

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041839
Gene: ENSMUSG00000038991
AA Change: K99E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Thioredoxin 49 153 5.3e-28 PFAM
low complexity region 156 172 N/A INTRINSIC
Pfam:Thioredoxin 176 279 2.8e-30 PFAM
Pfam:Thioredoxin 308 412 6.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160653
AA Change: K26E

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124401
Gene: ENSMUSG00000038991
AA Change: K26E

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 80 6.3e-22 PFAM
low complexity region 83 99 N/A INTRINSIC
Pfam:Thioredoxin 103 206 4.2e-31 PFAM
Pfam:Thioredoxin 235 339 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162075
AA Change: K5E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124516
Gene: ENSMUSG00000038991
AA Change: K5E

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 59 1.5e-13 PFAM
low complexity region 62 78 N/A INTRINSIC
Pfam:Thioredoxin 82 185 5e-31 PFAM
Pfam:Thioredoxin 214 318 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224471
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal endoplasmic reticulum (ER)-signal sequence, three catalytically active thioredoxin domains and a C-terminal ER-retention sequence. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S5 gene. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Txndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0164:Txndc5 UTSW 13 38507953 missense probably damaging 1.00
R0164:Txndc5 UTSW 13 38507953 missense probably damaging 1.00
R0691:Txndc5 UTSW 13 38507896 missense probably damaging 1.00
R0741:Txndc5 UTSW 13 38528260 missense possibly damaging 0.94
R3810:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R3811:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R5009:Txndc5 UTSW 13 38528184 unclassified probably null
R5472:Txndc5 UTSW 13 38513125 missense possibly damaging 0.65
R6089:Txndc5 UTSW 13 38523416 start codon destroyed probably null 0.70
R6292:Txndc5 UTSW 13 38528184 unclassified probably null
R6443:Txndc5 UTSW 13 38528203 missense possibly damaging 0.56
X0067:Txndc5 UTSW 13 38523387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATTCAGCGCCTGGGATC -3'
(R):5'- AGAACAGTGTCGTTGTGAGG -3'

Sequencing Primer
(F):5'- CCTGGGATCTAGGAAGGAAGTTACC -3'
(R):5'- AGGTATCTGTCTGCTGCAGAG -3'
Posted On2015-04-02