Incidental Mutation 'R3812:Top2b'
ID 274113
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
MMRRC Submission 040768-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R3812 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 16409189 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 777 (I777M)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
AlphaFold Q64511
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.8018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,186,967 (GRCm39) V73A probably benign Het
Bpifb2 T A 2: 153,733,871 (GRCm39) D404E probably benign Het
Ccdc150 A G 1: 54,407,469 (GRCm39) M1082V probably benign Het
Cyp4a31 T C 4: 115,423,706 (GRCm39) S137P probably benign Het
Cyp4f15 A G 17: 32,905,151 (GRCm39) I45V probably benign Het
Fbxw28 C A 9: 109,167,598 (GRCm39) C53F possibly damaging Het
Galntl5 T C 5: 25,391,178 (GRCm39) F26L probably benign Het
Gm9637 A T 14: 19,402,398 (GRCm38) noncoding transcript Het
Lcmt2 G A 2: 120,969,187 (GRCm39) A632V probably benign Het
Metap2 A T 10: 93,706,026 (GRCm39) L252* probably null Het
Myo1a A G 10: 127,543,284 (GRCm39) N180S possibly damaging Het
Nlrp4a T C 7: 26,149,118 (GRCm39) W242R probably benign Het
Or4c12b T A 2: 89,647,395 (GRCm39) S242T probably damaging Het
Or5w18 C T 2: 87,633,396 (GRCm39) S221F possibly damaging Het
Or5w19 T A 2: 87,698,745 (GRCm39) S137T probably damaging Het
Otogl A G 10: 107,735,332 (GRCm39) Y151H probably damaging Het
Pkd1 T C 17: 24,784,615 (GRCm39) V387A probably benign Het
Polm A G 11: 5,779,512 (GRCm39) F429L possibly damaging Het
Sco2 T C 15: 89,257,882 (GRCm39) probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sorbs2 A G 8: 46,216,067 (GRCm39) T105A probably benign Het
Syt10 A T 15: 89,675,000 (GRCm39) C449S probably benign Het
Txndc5 T C 13: 38,707,381 (GRCm39) K99E probably benign Het
Usp34 T A 11: 23,414,517 (GRCm39) F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,305,717 (GRCm39) S40P probably damaging Het
Zfp292 A T 4: 34,810,326 (GRCm39) L906Q probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R1987:Top2b UTSW 14 16,398,916 (GRCm38) missense probably damaging 0.99
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3707:Top2b UTSW 14 16,388,447 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4581:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4698:Top2b UTSW 14 16,387,331 (GRCm38) nonsense probably null
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6512:Top2b UTSW 14 16,409,854 (GRCm38) missense possibly damaging 0.94
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7562:Top2b UTSW 14 16,412,946 (GRCm38) missense probably benign 0.04
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TTTGAAGTACTCTCCCTGAGC -3'

Sequencing Primer
(F):5'- CTGAAGATGGGATCAACTGAGAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'
Posted On 2015-04-02