Incidental Mutation 'R3812:Gm9637'
ID274114
Institutional Source Beutler Lab
Gene Symbol Gm9637
Ensembl Gene ENSMUSG00000093814
Gene Namepredicted gene 9637
Synonyms
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location19401727-19402599 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 19402398 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179141
SMART Domains Protein: ENSMUSP00000137522
Gene: ENSMUSG00000093814

DomainStartEndE-ValueType
S_TKc 36 283 1.12e-85 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Gm9637
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Gm9637 APN 14 19402545 exon noncoding transcript
IGL02449:Gm9637 APN 14 19402436 exon noncoding transcript
IGL02492:Gm9637 APN 14 19402182 exon noncoding transcript
IGL03060:Gm9637 APN 14 19402173 exon noncoding transcript
R0062:Gm9637 UTSW 14 19402570 exon noncoding transcript
R0621:Gm9637 UTSW 14 19402011 exon noncoding transcript
R1122:Gm9637 UTSW 14 19401879 exon noncoding transcript
R1762:Gm9637 UTSW 14 19402408 exon noncoding transcript
R1812:Gm9637 UTSW 14 19402395 exon noncoding transcript
R2880:Gm9637 UTSW 14 19401978 exon noncoding transcript
R3685:Gm9637 UTSW 14 19401950 exon noncoding transcript
R3810:Gm9637 UTSW 14 19402398 exon noncoding transcript
R5415:Gm9637 UTSW 14 19402143 exon noncoding transcript
Z1088:Gm9637 UTSW 14 19401731 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACTGGAGGGCATACACCATC -3'
(R):5'- ACCTATCAGCAATGAGGTGGC -3'

Sequencing Primer
(F):5'- GTTTAAACAGCCTGTGGAACTCC -3'
(R):5'- CAAGCATGTCAGGACCTCAGG -3'
Posted On2015-04-02