Incidental Mutation 'R3812:Sco2'
ID274115
Institutional Source Beutler Lab
Gene Symbol Sco2
Ensembl Gene ENSMUSG00000091780
Gene NameSCO2 cytochrome c oxidase assembly protein
Synonyms
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89371637-89373846 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 89373679 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000049968] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000227834] [ENSMUST00000228111] [ENSMUST00000228977]
Predicted Effect probably benign
Transcript: ENSMUST00000023285
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049968
SMART Domains Protein: ENSMUSP00000053112
Gene: ENSMUSG00000047394

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 24 60 1.4e-4 PFAM
Pfam:SHIPPO-rpt 101 129 1.6e-3 PFAM
Pfam:SHIPPO-rpt 138 172 2.7e-6 PFAM
Pfam:SHIPPO-rpt 181 211 2.5e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140665
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151523
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227203
Predicted Effect probably benign
Transcript: ENSMUST00000227834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228005
Predicted Effect probably benign
Transcript: ENSMUST00000228111
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele and a knock-in allele exhibit muscle weakness and reduced exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Sco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Sco2 APN 15 89371721 missense probably benign 0.02
R2020:Sco2 UTSW 15 89371860 missense probably damaging 1.00
R3811:Sco2 UTSW 15 89373679 utr 5 prime probably benign
R5686:Sco2 UTSW 15 89371972 nonsense probably null
R5815:Sco2 UTSW 15 89372371 missense probably benign
R7421:Sco2 UTSW 15 89371720 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCGATCTGATAGCACGAGC -3'
(R):5'- CGGATATCAACGGCACCAGATC -3'

Sequencing Primer
(F):5'- GAGCGCCCCCTGGAGAG -3'
(R):5'- TTCCTGGTCCTGGCACGTG -3'
Posted On2015-04-02