Mutagenetix > Incidental Mutation

Incidental Mutation 'R3812:Arid2'

274117

Institutional Source

Beutler Lab

Gene Symbol

Arid2

Ensembl Gene

ENSMUSG00000033237

Gene Name

AT rich interactive domain 2 (ARID, RFX-like)

Synonyms

4432409D24Rik, 1700124K17Rik, zipzap/p200

MMRRC Submission

040768-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3812 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96287518-96404992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96289086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 73 (V73A)

Ref Sequence

ENSEMBL: ENSMUSP00000093969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096250] [ENSMUST00000134985]

AlphaFold

E9Q7E2

Predicted Effect

probably benign
Transcript: ENSMUST00000096250
AA Change: V73A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: V73A

Domain	Start	End	E-Value	Type
ARID	10	101	9.67e-36	SMART
BRIGHT	14	106	3.67e-34	SMART
Pfam:RFX_DNA_binding	521	603	1.7e-26	PFAM
internal_repeat_1	767	843	3.29e-6	PROSPERO
low complexity region	902	942	N/A	INTRINSIC
low complexity region	965	986	N/A	INTRINSIC
low complexity region	1012	1054	N/A	INTRINSIC
low complexity region	1118	1131	N/A	INTRINSIC
internal_repeat_1	1132	1215	3.29e-6	PROSPERO
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1590	1614	N/A	INTRINSIC
ZnF_C2H2	1626	1651	4.34e0	SMART
ZnF_C2H2	1659	1684	4.74e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134985
AA Change: V73A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135829
Gene: ENSMUSG00000033237
AA Change: V73A

Domain	Start	End	E-Value	Type
ARID	10	101	9.67e-36	SMART
BRIGHT	14	106	3.67e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185067

Meta Mutation Damage Score

0.0719

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb2	T	A	2: 153,891,951 (GRCm38)	D404E	probably benign	Het
Ccdc150	A	G	1: 54,368,310 (GRCm38)	M1082V	probably benign	Het
Cyp4a31	T	C	4: 115,566,509 (GRCm38)	S137P	probably benign	Het
Cyp4f15	A	G	17: 32,686,177 (GRCm38)	I45V	probably benign	Het
Fbxw28	C	A	9: 109,338,530 (GRCm38)	C53F	possibly damaging	Het
Galntl5	T	C	5: 25,186,180 (GRCm38)	F26L	probably benign	Het
Gm9637	A	T	14: 19,402,398 (GRCm38)		noncoding transcript	Het
Lcmt2	G	A	2: 121,138,706 (GRCm38)	A632V	probably benign	Het
Metap2	A	T	10: 93,870,164 (GRCm38)	L252*	probably null	Het
Myo1a	A	G	10: 127,707,415 (GRCm38)	N180S	possibly damaging	Het
Nlrp4a	T	C	7: 26,449,693 (GRCm38)	W242R	probably benign	Het
Olfr1143	C	T	2: 87,803,052 (GRCm38)	S221F	possibly damaging	Het
Olfr1152	T	A	2: 87,868,401 (GRCm38)	S137T	probably damaging	Het
Olfr1255	T	A	2: 89,817,051 (GRCm38)	S242T	probably damaging	Het
Otogl	A	G	10: 107,899,471 (GRCm38)	Y151H	probably damaging	Het
Pkd1	T	C	17: 24,565,641 (GRCm38)	V387A	probably benign	Het
Polm	A	G	11: 5,829,512 (GRCm38)	F429L	possibly damaging	Het
Sco2	T	C	15: 89,373,679 (GRCm38)		probably benign	Het
Secisbp2l	C	T	2: 125,740,737 (GRCm38)	G933D	possibly damaging	Het
Sorbs2	A	G	8: 45,763,030 (GRCm38)	T105A	probably benign	Het
Syt10	A	T	15: 89,790,797 (GRCm38)	C449S	probably benign	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Txndc5	T	C	13: 38,523,405 (GRCm38)	K99E	probably benign	Het
Usp34	T	A	11: 23,464,517 (GRCm38)	F2820Y	possibly damaging	Het
Vmn1r170	T	C	7: 23,606,292 (GRCm38)	S40P	probably damaging	Het
Zfp292	A	T	4: 34,810,326 (GRCm38)	L906Q	probably damaging	Het

Other mutations in Arid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Arid2	APN	15	96,372,302 (GRCm38)	missense	probably benign
IGL00321:Arid2	APN	15	96,289,089 (GRCm38)	missense	probably damaging	0.97
IGL00434:Arid2	APN	15	96,371,300 (GRCm38)	missense	probably damaging	0.99
IGL00576:Arid2	APN	15	96,356,758 (GRCm38)	missense	probably damaging	0.99
IGL00766:Arid2	APN	15	96,370,405 (GRCm38)	missense	probably benign	0.09
IGL01563:Arid2	APN	15	96,372,397 (GRCm38)	missense	probably damaging	0.99
IGL01697:Arid2	APN	15	96,361,572 (GRCm38)	critical splice acceptor site	probably null
IGL01845:Arid2	APN	15	96,356,797 (GRCm38)	missense	probably damaging	1.00
IGL02159:Arid2	APN	15	96,358,912 (GRCm38)	splice site	probably benign
IGL02341:Arid2	APN	15	96,372,185 (GRCm38)	missense	probably benign
IGL02416:Arid2	APN	15	96,350,055 (GRCm38)	missense	possibly damaging	0.63
IGL02578:Arid2	APN	15	96,372,235 (GRCm38)	missense	probably benign	0.00
IGL02598:Arid2	APN	15	96,371,536 (GRCm38)	missense	probably damaging	1.00
IGL02644:Arid2	APN	15	96,368,708 (GRCm38)	missense	probably damaging	1.00
IGL02653:Arid2	APN	15	96,287,702 (GRCm38)	missense	probably damaging	0.99
IGL03115:Arid2	APN	15	96,370,273 (GRCm38)	missense	probably damaging	1.00
IGL03137:Arid2	APN	15	96,371,318 (GRCm38)	missense	probably benign	0.44
IGL03220:Arid2	APN	15	96,361,772 (GRCm38)	missense	probably damaging	0.99
IGL03249:Arid2	APN	15	96,401,965 (GRCm38)	missense	probably damaging	1.00
IGL03256:Arid2	APN	15	96,370,762 (GRCm38)	missense	probably benign	0.18
IGL03386:Arid2	APN	15	96,361,574 (GRCm38)	missense	probably damaging	1.00
H8562:Arid2	UTSW	15	96,369,546 (GRCm38)	missense	possibly damaging	0.77
I2288:Arid2	UTSW	15	96,369,511 (GRCm38)	missense	possibly damaging	0.95
R0254:Arid2	UTSW	15	96,370,571 (GRCm38)	missense	probably damaging	0.97
R0284:Arid2	UTSW	15	96,378,967 (GRCm38)	splice site	probably benign
R0347:Arid2	UTSW	15	96,370,952 (GRCm38)	missense	probably benign	0.01
R0366:Arid2	UTSW	15	96,361,720 (GRCm38)	splice site	probably benign
R0400:Arid2	UTSW	15	96,356,925 (GRCm38)	unclassified	probably benign
R0650:Arid2	UTSW	15	96,402,049 (GRCm38)	missense	possibly damaging	0.47
R0651:Arid2	UTSW	15	96,402,049 (GRCm38)	missense	possibly damaging	0.47
R1034:Arid2	UTSW	15	96,369,505 (GRCm38)	missense	probably benign	0.01
R1615:Arid2	UTSW	15	96,371,654 (GRCm38)	missense	possibly damaging	0.59
R1696:Arid2	UTSW	15	96,370,183 (GRCm38)	missense	probably benign	0.01
R2024:Arid2	UTSW	15	96,361,799 (GRCm38)	missense	probably damaging	1.00
R2046:Arid2	UTSW	15	96,369,387 (GRCm38)	missense	probably damaging	1.00
R2069:Arid2	UTSW	15	96,362,590 (GRCm38)	missense	probably damaging	1.00
R2149:Arid2	UTSW	15	96,370,835 (GRCm38)	missense	probably damaging	1.00
R2300:Arid2	UTSW	15	96,402,006 (GRCm38)	missense	probably damaging	1.00
R2336:Arid2	UTSW	15	96,362,549 (GRCm38)	missense	probably damaging	1.00
R2359:Arid2	UTSW	15	96,361,878 (GRCm38)	missense	probably damaging	1.00
R2368:Arid2	UTSW	15	96,350,012 (GRCm38)	missense	possibly damaging	0.83
R2829:Arid2	UTSW	15	96,369,454 (GRCm38)	missense	possibly damaging	0.95
R3013:Arid2	UTSW	15	96,361,936 (GRCm38)	missense	probably damaging	1.00
R3109:Arid2	UTSW	15	96,356,746 (GRCm38)	missense	probably damaging	1.00
R3765:Arid2	UTSW	15	96,370,714 (GRCm38)	missense	probably benign	0.01
R3785:Arid2	UTSW	15	96,372,558 (GRCm38)	missense	possibly damaging	0.83
R3811:Arid2	UTSW	15	96,289,086 (GRCm38)	missense	probably benign	0.01
R3813:Arid2	UTSW	15	96,369,950 (GRCm38)	missense	probably benign	0.26
R3843:Arid2	UTSW	15	96,351,840 (GRCm38)	missense	possibly damaging	0.86
R3978:Arid2	UTSW	15	96,363,622 (GRCm38)	missense	probably damaging	1.00
R4279:Arid2	UTSW	15	96,371,756 (GRCm38)	missense	probably damaging	1.00
R4569:Arid2	UTSW	15	96,392,462 (GRCm38)	missense	probably damaging	1.00
R4597:Arid2	UTSW	15	96,370,856 (GRCm38)	missense	probably damaging	1.00
R5020:Arid2	UTSW	15	96,371,988 (GRCm38)	missense	probably damaging	0.96
R5154:Arid2	UTSW	15	96,401,985 (GRCm38)	missense	probably damaging	1.00
R5303:Arid2	UTSW	15	96,392,468 (GRCm38)	missense	probably damaging	1.00
R5620:Arid2	UTSW	15	96,372,506 (GRCm38)	missense	probably benign	0.20
R5766:Arid2	UTSW	15	96,372,205 (GRCm38)	missense	probably benign	0.01
R6005:Arid2	UTSW	15	96,370,972 (GRCm38)	missense	probably benign
R6169:Arid2	UTSW	15	96,368,677 (GRCm38)	missense	probably benign	0.36
R6216:Arid2	UTSW	15	96,356,909 (GRCm38)	missense	probably benign	0.18
R6392:Arid2	UTSW	15	96,361,602 (GRCm38)	missense	probably damaging	0.99
R6430:Arid2	UTSW	15	96,363,694 (GRCm38)	missense	probably benign
R6454:Arid2	UTSW	15	96,372,413 (GRCm38)	missense	probably benign	0.20
R6672:Arid2	UTSW	15	96,362,345 (GRCm38)	missense	probably benign	0.30
R6776:Arid2	UTSW	15	96,370,949 (GRCm38)	missense	probably benign	0.00
R6985:Arid2	UTSW	15	96,370,148 (GRCm38)	missense	probably benign	0.06
R7132:Arid2	UTSW	15	96,350,013 (GRCm38)	missense	possibly damaging	0.67
R7133:Arid2	UTSW	15	96,378,875 (GRCm38)	missense	probably damaging	0.99
R7453:Arid2	UTSW	15	96,370,724 (GRCm38)	missense	probably benign
R7562:Arid2	UTSW	15	96,401,968 (GRCm38)	missense	probably damaging	1.00
R7594:Arid2	UTSW	15	96,390,994 (GRCm38)	missense	probably damaging	1.00
R7692:Arid2	UTSW	15	96,356,697 (GRCm38)	nonsense	probably null
R7792:Arid2	UTSW	15	96,369,375 (GRCm38)	missense	probably benign	0.05
R8036:Arid2	UTSW	15	96,368,744 (GRCm38)	missense	probably damaging	1.00
R8094:Arid2	UTSW	15	96,368,711 (GRCm38)	missense	possibly damaging	0.86
R8327:Arid2	UTSW	15	96,362,604 (GRCm38)	missense	probably damaging	1.00
R9065:Arid2	UTSW	15	96,371,491 (GRCm38)	missense	probably benign	0.44
R9143:Arid2	UTSW	15	96,361,834 (GRCm38)	missense	probably damaging	0.99
R9320:Arid2	UTSW	15	96,371,186 (GRCm38)	missense	probably damaging	1.00
R9346:Arid2	UTSW	15	96,287,911 (GRCm38)	missense	probably benign	0.01
R9519:Arid2	UTSW	15	96,289,067 (GRCm38)	missense	possibly damaging	0.46
R9651:Arid2	UTSW	15	96,358,941 (GRCm38)	missense	probably benign	0.44
X0024:Arid2	UTSW	15	96,372,490 (GRCm38)	missense	probably benign	0.00
X0066:Arid2	UTSW	15	96,356,804 (GRCm38)	missense	probably damaging	1.00
Z1177:Arid2	UTSW	15	96,390,986 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGGGCTCTCTGATGAAAAC -3'
(R):5'- TCTCAGACTGCAATTAACAAGGG -3'

Sequencing Primer
(F):5'- TAGTGATTCAAGCAGCCCTG -3'
(R):5'- TCAGACTGCAATTAACAAGGGATTGG -3'

Posted On

2015-04-02