Incidental Mutation 'R3812:Cyp4f15'
ID274120
Institutional Source Beutler Lab
Gene Symbol Cyp4f15
Ensembl Gene ENSMUSG00000073424
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 15
Synonyms
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32685627-32703352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32686177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 45 (I45V)
Ref Sequence ENSEMBL: ENSMUSP00000129264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008801] [ENSMUST00000168171]
Predicted Effect probably benign
Transcript: ENSMUST00000008801
AA Change: I45V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000008801
Gene: ENSMUSG00000073424
AA Change: I45V

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:p450 57 520 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167789
Predicted Effect probably benign
Transcript: ENSMUST00000168171
AA Change: I45V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129264
Gene: ENSMUSG00000073424
AA Change: I45V

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:p450 57 527 3.2e-133 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F8, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and functions as a 19-hydroxylase of prostaglandins in seminal vesicles. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F3, is approximately 18 kb away. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ccdc150 A G 1: 54,368,310 M1082V probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Cyp4f15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Cyp4f15 APN 17 32686157 missense probably benign 0.01
IGL01813:Cyp4f15 APN 17 32686157 missense probably benign 0.01
IGL02394:Cyp4f15 APN 17 32692635 missense possibly damaging 0.76
IGL02547:Cyp4f15 APN 17 32700255 missense probably benign 0.03
IGL02743:Cyp4f15 APN 17 32699952 missense possibly damaging 0.56
IGL03120:Cyp4f15 APN 17 32690764 missense probably damaging 0.97
IGL03124:Cyp4f15 APN 17 32685812 critical splice donor site probably null
IGL03342:Cyp4f15 APN 17 32697936 missense probably damaging 1.00
PIT4472001:Cyp4f15 UTSW 17 32702824 missense probably damaging 0.99
R2016:Cyp4f15 UTSW 17 32702159 missense probably damaging 1.00
R2892:Cyp4f15 UTSW 17 32686208 missense probably benign
R4803:Cyp4f15 UTSW 17 32692580 missense probably benign 0.00
R5180:Cyp4f15 UTSW 17 32690740 missense probably benign 0.21
R5199:Cyp4f15 UTSW 17 32702372 missense probably benign
R5787:Cyp4f15 UTSW 17 32702808 missense probably damaging 1.00
R6695:Cyp4f15 UTSW 17 32692612 nonsense probably null
Z1088:Cyp4f15 UTSW 17 32692690 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGATCTCTCCTCCTACAAACAGC -3'
(R):5'- ATGCTGGAGGACTTCAGACC -3'

Sequencing Primer
(F):5'- CCTGGTCCATTATGCCTGATGG -3'
(R):5'- TGGAGGACTTCAGACCCATCC -3'
Posted On2015-04-02