Incidental Mutation 'R3813:Rbm17'
ID274124
Institutional Source Beutler Lab
Gene Symbol Rbm17
Ensembl Gene ENSMUSG00000037197
Gene NameRNA binding motif protein 17
Synonyms2700027J02Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11585437-11604153 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 11595435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040314] [ENSMUST00000156469]
Predicted Effect probably benign
Transcript: ENSMUST00000040314
SMART Domains Protein: ENSMUSP00000041831
Gene: ENSMUSG00000037197

DomainStartEndE-ValueType
coiled coil region 106 144 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
G_patch 233 279 4.97e-13 SMART
RRM 310 389 4.69e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195047
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Rbm17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Rbm17 APN 2 11595438 unclassified probably benign
R0178:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R0180:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R1457:Rbm17 UTSW 2 11593461 missense probably benign 0.11
R1606:Rbm17 UTSW 2 11595397 missense probably benign
R1672:Rbm17 UTSW 2 11585719 missense possibly damaging 0.95
R1941:Rbm17 UTSW 2 11589074 missense possibly damaging 0.95
R2327:Rbm17 UTSW 2 11598131 missense probably damaging 1.00
R2859:Rbm17 UTSW 2 11590704 missense possibly damaging 0.84
R5887:Rbm17 UTSW 2 11585674 missense probably damaging 1.00
R6866:Rbm17 UTSW 2 11598090 missense probably benign 0.06
R6985:Rbm17 UTSW 2 11590693 missense probably benign
R8428:Rbm17 UTSW 2 11600630 missense possibly damaging 0.80
Z1176:Rbm17 UTSW 2 11596768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGTTCACGGGAAAGGG -3'
(R):5'- CCTATGAATTATGCCCATGTATCC -3'

Sequencing Primer
(F):5'- CATGTTCACGGGAAAGGGAAAGC -3'
(R):5'- TTGCCAAGAGGAAGTCAT -3'
Posted On2015-04-02