Mutagenetix > Incidental Mutation

Incidental Mutation 'R3813:Cubn'

274125

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13294325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 3179 (Y3179F)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: Y3179F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: Y3179F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149137

Meta Mutation Damage Score

0.4189

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,491,820 (GRCm38)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,456,697 (GRCm38)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,381,849 (GRCm38)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,427,056 (GRCm38)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,278,418 (GRCm38)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,282,919 (GRCm38)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,294,230 (GRCm38)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,467,710 (GRCm38)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,381,927 (GRCm38)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,456,623 (GRCm38)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,278,408 (GRCm38)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,478,093 (GRCm38)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,310,566 (GRCm38)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,465,908 (GRCm38)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,284,041 (GRCm38)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,350,862 (GRCm38)	splice site	probably benign
IGL01534:Cubn	APN	2	13,465,933 (GRCm38)	nonsense	probably null
IGL01584:Cubn	APN	2	13,308,661 (GRCm38)	splice site	probably benign
IGL01595:Cubn	APN	2	13,325,216 (GRCm38)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,306,274 (GRCm38)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,489,936 (GRCm38)	nonsense	probably null
IGL01972:Cubn	APN	2	13,446,072 (GRCm38)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,287,594 (GRCm38)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,339,846 (GRCm38)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,381,837 (GRCm38)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,427,834 (GRCm38)	splice site	probably null
IGL02491:Cubn	APN	2	13,321,228 (GRCm38)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,325,226 (GRCm38)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,446,032 (GRCm38)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,445,040 (GRCm38)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,294,370 (GRCm38)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,318,312 (GRCm38)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,287,094 (GRCm38)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,355,689 (GRCm38)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,426,967 (GRCm38)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,360,329 (GRCm38)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,478,057 (GRCm38)	splice site	probably null
mellow	UTSW	2	13,478,078 (GRCm38)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,468,852 (GRCm38)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,491,750 (GRCm38)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,306,432 (GRCm38)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,356,709 (GRCm38)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,476,035 (GRCm38)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,440,514 (GRCm38)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,424,694 (GRCm38)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,310,507 (GRCm38)	splice site	probably benign
R0364:Cubn	UTSW	2	13,310,507 (GRCm38)	splice site	probably benign
R0383:Cubn	UTSW	2	13,430,959 (GRCm38)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,469,764 (GRCm38)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,469,763 (GRCm38)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,444,267 (GRCm38)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,428,680 (GRCm38)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,360,252 (GRCm38)	splice site	probably null
R0735:Cubn	UTSW	2	13,491,689 (GRCm38)	splice site	probably benign
R0780:Cubn	UTSW	2	13,456,613 (GRCm38)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,362,328 (GRCm38)	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13,336,242 (GRCm38)	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13,445,000 (GRCm38)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,287,568 (GRCm38)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,360,319 (GRCm38)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,325,288 (GRCm38)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,325,288 (GRCm38)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,476,120 (GRCm38)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,427,105 (GRCm38)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,287,661 (GRCm38)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,427,967 (GRCm38)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,469,789 (GRCm38)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,489,317 (GRCm38)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,308,561 (GRCm38)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,323,002 (GRCm38)	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13,310,526 (GRCm38)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,278,538 (GRCm38)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,340,017 (GRCm38)	splice site	probably null
R2021:Cubn	UTSW	2	13,308,549 (GRCm38)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,336,167 (GRCm38)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,444,378 (GRCm38)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,336,167 (GRCm38)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,318,242 (GRCm38)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,404,080 (GRCm38)	nonsense	probably null
R2369:Cubn	UTSW	2	13,491,217 (GRCm38)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,476,150 (GRCm38)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,318,272 (GRCm38)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,278,356 (GRCm38)	splice site	probably null
R2850:Cubn	UTSW	2	13,322,953 (GRCm38)	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13,430,834 (GRCm38)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,358,139 (GRCm38)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,362,347 (GRCm38)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,362,347 (GRCm38)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,358,162 (GRCm38)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,333,508 (GRCm38)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,350,943 (GRCm38)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,350,943 (GRCm38)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,350,943 (GRCm38)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,331,585 (GRCm38)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,427,914 (GRCm38)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,360,353 (GRCm38)	missense	probably benign	0.01
R3845:Cubn	UTSW	2	13,283,008 (GRCm38)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,283,008 (GRCm38)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,286,980 (GRCm38)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,326,677 (GRCm38)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,313,999 (GRCm38)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,428,563 (GRCm38)	intron	probably benign
R4405:Cubn	UTSW	2	13,466,030 (GRCm38)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,428,749 (GRCm38)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,313,979 (GRCm38)	splice site	probably null
R4770:Cubn	UTSW	2	13,314,767 (GRCm38)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,287,024 (GRCm38)	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13,351,058 (GRCm38)	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13,459,076 (GRCm38)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,325,225 (GRCm38)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,489,910 (GRCm38)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,348,045 (GRCm38)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,287,568 (GRCm38)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,478,202 (GRCm38)	nonsense	probably null
R5305:Cubn	UTSW	2	13,388,939 (GRCm38)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,491,695 (GRCm38)	splice site	probably null
R5530:Cubn	UTSW	2	13,308,523 (GRCm38)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,350,932 (GRCm38)	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13,388,891 (GRCm38)	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13,320,023 (GRCm38)	splice site	probably benign
R5923:Cubn	UTSW	2	13,486,078 (GRCm38)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,325,184 (GRCm38)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,325,184 (GRCm38)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,430,897 (GRCm38)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,427,847 (GRCm38)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,308,618 (GRCm38)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,349,876 (GRCm38)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,478,078 (GRCm38)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,280,195 (GRCm38)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,476,123 (GRCm38)	missense	probably damaging	0.98
R6368:Cubn	UTSW	2	13,430,995 (GRCm38)	missense	probably damaging	0.96
R6383:Cubn	UTSW	2	13,427,835 (GRCm38)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,355,680 (GRCm38)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,294,203 (GRCm38)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,322,993 (GRCm38)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,459,002 (GRCm38)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,310,673 (GRCm38)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,430,872 (GRCm38)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,476,064 (GRCm38)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,321,255 (GRCm38)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,445,029 (GRCm38)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,444,253 (GRCm38)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,318,278 (GRCm38)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,348,029 (GRCm38)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,381,837 (GRCm38)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,486,789 (GRCm38)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,306,281 (GRCm38)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,306,280 (GRCm38)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,319,858 (GRCm38)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,342,498 (GRCm38)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,351,003 (GRCm38)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,424,739 (GRCm38)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,340,332 (GRCm38)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,468,771 (GRCm38)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,287,064 (GRCm38)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,426,967 (GRCm38)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,322,993 (GRCm38)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,322,993 (GRCm38)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,455,509 (GRCm38)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,489,917 (GRCm38)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,348,178 (GRCm38)	missense	probably benign
R7700:Cubn	UTSW	2	13,489,917 (GRCm38)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,348,178 (GRCm38)	missense	probably benign
R7751:Cubn	UTSW	2	13,360,365 (GRCm38)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,280,078 (GRCm38)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,348,150 (GRCm38)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,468,869 (GRCm38)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,424,727 (GRCm38)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,332,355 (GRCm38)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,336,086 (GRCm38)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,479,178 (GRCm38)	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13,331,660 (GRCm38)	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13,388,848 (GRCm38)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,294,318 (GRCm38)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,349,877 (GRCm38)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,486,802 (GRCm38)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,306,463 (GRCm38)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,340,242 (GRCm38)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,430,847 (GRCm38)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,428,724 (GRCm38)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,325,160 (GRCm38)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,428,756 (GRCm38)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,381,799 (GRCm38)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,427,847 (GRCm38)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,314,044 (GRCm38)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,308,520 (GRCm38)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,383,959 (GRCm38)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,308,566 (GRCm38)	nonsense	probably null
R8874:Cubn	UTSW	2	13,360,346 (GRCm38)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,456,655 (GRCm38)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,287,103 (GRCm38)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,332,465 (GRCm38)	splice site	probably benign
R9261:Cubn	UTSW	2	13,278,451 (GRCm38)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,381,892 (GRCm38)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,458,956 (GRCm38)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,287,699 (GRCm38)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,478,134 (GRCm38)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,321,180 (GRCm38)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,314,718 (GRCm38)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,428,719 (GRCm38)	missense	probably benign
X0018:Cubn	UTSW	2	13,458,986 (GRCm38)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,476,076 (GRCm38)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,342,581 (GRCm38)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,322,962 (GRCm38)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,383,992 (GRCm38)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,294,229 (GRCm38)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,381,825 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCACTGTAAGCAATAGTGTTC -3'
(R):5'- TGGGAGAAAATGGAACCTCTCC -3'

Sequencing Primer
(F):5'- GCAATAGTGTTCTCATTTTCAAGGC -3'
(R):5'- AATGGAACCTCTCCTCTTTAAAATCC -3'

Posted On

2015-04-02