Incidental Mutation 'R3813:Dll4'
ID274133
Institutional Source Beutler Lab
Gene Symbol Dll4
Ensembl Gene ENSMUSG00000027314
Gene Namedelta like canonical Notch ligand 4
SynonymsDelta4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119325784-119335962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119331029 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 364 (T364N)
Ref Sequence ENSEMBL: ENSMUSP00000099575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102517
AA Change: T364N

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: T364N

DomainStartEndE-ValueType
Pfam:MNNL 27 92 7.3e-21 PFAM
low complexity region 139 150 N/A INTRINSIC
DSL 156 218 1.98e-23 SMART
EGF 222 252 5.62e0 SMART
EGF 253 283 5.79e-2 SMART
EGF_CA 285 323 1.38e-8 SMART
EGF_CA 329 361 5.36e-6 SMART
EGF 366 401 4.35e-6 SMART
EGF 406 439 1.44e-6 SMART
EGF_CA 441 477 2.33e-6 SMART
EGF 484 519 9.33e-6 SMART
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156538
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Dll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Dll4 APN 2 119331109 missense probably damaging 1.00
IGL01149:Dll4 APN 2 119332745 missense probably damaging 1.00
IGL02511:Dll4 APN 2 119326466 missense probably damaging 0.99
PIT4519001:Dll4 UTSW 2 119332416 missense probably benign 0.01
R0316:Dll4 UTSW 2 119331153 missense probably damaging 1.00
R0725:Dll4 UTSW 2 119332689 missense probably damaging 1.00
R0840:Dll4 UTSW 2 119326485 missense probably benign 0.01
R1014:Dll4 UTSW 2 119331157 missense probably damaging 1.00
R1650:Dll4 UTSW 2 119331130 missense probably damaging 1.00
R3974:Dll4 UTSW 2 119334092 missense probably damaging 0.98
R5320:Dll4 UTSW 2 119326487 missense probably damaging 0.97
R6166:Dll4 UTSW 2 119334626 critical splice acceptor site probably null
R6305:Dll4 UTSW 2 119330657 missense probably benign 0.01
R6455:Dll4 UTSW 2 119333795 intron probably null
R6617:Dll4 UTSW 2 119327931 missense probably benign
R6843:Dll4 UTSW 2 119325994 start gained probably benign
R7204:Dll4 UTSW 2 119328573 missense probably damaging 0.98
R7251:Dll4 UTSW 2 119332292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATGCATGCATGGATGGGC -3'
(R):5'- ACGATTTTCTCAGGCTCTCTGG -3'

Sequencing Primer
(F):5'- CATGCATGGATGGGCACTCTG -3'
(R):5'- CCACTTCAGCAGGTTGGTAAG -3'
Posted On2015-04-02