Mutagenetix > Incidental Mutations

Incidental Mutation 'R3813:Dll4'

274133

Institutional Source

Beutler Lab

Gene Symbol

Dll4

Ensembl Gene

ENSMUSG00000027314

Gene Name

delta like canonical Notch ligand 4

Synonyms

Delta4

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119325784-119335962 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 119331029 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 364 (T364N)

Ref Sequence

ENSEMBL: ENSMUSP00000099575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102517]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102517
AA Change: T364N

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: T364N

Domain	Start	End	E-Value	Type
Pfam:MNNL	27	92	7.3e-21	PFAM
low complexity region	139	150	N/A	INTRINSIC
DSL	156	218	1.98e-23	SMART
EGF	222	252	5.62e0	SMART
EGF	253	283	5.79e-2	SMART
EGF_CA	285	323	1.38e-8	SMART
EGF_CA	329	361	5.36e-6	SMART
EGF	366	401	4.35e-6	SMART
EGF	406	439	1.44e-6	SMART
EGF_CA	441	477	2.33e-6	SMART
EGF	484	519	9.33e-6	SMART
transmembrane domain	530	552	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127102

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156538

Meta Mutation Damage Score

0.0633

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Dll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Dll4	APN	2	119331109	missense	probably damaging	1.00
IGL01149:Dll4	APN	2	119332745	missense	probably damaging	1.00
IGL02511:Dll4	APN	2	119326466	missense	probably damaging	0.99
PIT4519001:Dll4	UTSW	2	119332416	missense	probably benign	0.01
R0316:Dll4	UTSW	2	119331153	missense	probably damaging	1.00
R0725:Dll4	UTSW	2	119332689	missense	probably damaging	1.00
R0840:Dll4	UTSW	2	119326485	missense	probably benign	0.01
R1014:Dll4	UTSW	2	119331157	missense	probably damaging	1.00
R1650:Dll4	UTSW	2	119331130	missense	probably damaging	1.00
R3974:Dll4	UTSW	2	119334092	missense	probably damaging	0.98
R5320:Dll4	UTSW	2	119326487	missense	probably damaging	0.97
R6166:Dll4	UTSW	2	119334626	critical splice acceptor site	probably null
R6305:Dll4	UTSW	2	119330657	missense	probably benign	0.01
R6455:Dll4	UTSW	2	119333795	splice site	probably null
R6617:Dll4	UTSW	2	119327931	missense	probably benign
R6843:Dll4	UTSW	2	119325994	start gained	probably benign
R7204:Dll4	UTSW	2	119328573	missense	probably damaging	0.98
R7251:Dll4	UTSW	2	119332292	missense	probably damaging	1.00
R9021:Dll4	UTSW	2	119332573	frame shift	probably null
R9022:Dll4	UTSW	2	119332573	frame shift	probably null
Z1176:Dll4	UTSW	2	119326052	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TATATGCATGCATGGATGGGC -3'
(R):5'- ACGATTTTCTCAGGCTCTCTGG -3'

Sequencing Primer
(F):5'- CATGCATGGATGGGCACTCTG -3'
(R):5'- CCACTTCAGCAGGTTGGTAAG -3'

Posted On

2015-04-02