Mutagenetix > Incidental Mutation

Incidental Mutation 'R3813:Manba'

274137

Institutional Source

Beutler Lab

Gene Symbol

Manba

Ensembl Gene

ENSMUSG00000028164

Gene Name

mannosidase, beta A, lysosomal

Synonyms

B930014J03Rik, Bmn, 2410030O07Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135485611-135571404 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135563262 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 643 (E643K)

Ref Sequence

ENSEMBL: ENSMUSP00000029814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029814]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029814
AA Change: E643K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: E643K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Glyco_hydro_2_N	42	211	6.5e-11	PFAM
Pfam:Glyco_hydro_2_C	340	595	3.8e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134478

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153412

Meta Mutation Damage Score

0.1724

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Manba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Manba	APN	3	135554780	nonsense	probably null
IGL01443:Manba	APN	3	135544828	missense	probably damaging	1.00
IGL01796:Manba	APN	3	135542389	missense	probably damaging	1.00
IGL02396:Manba	APN	3	135544764	missense	probably damaging	1.00
IGL02471:Manba	APN	3	135507008	splice site	probably benign
IGL02809:Manba	APN	3	135547560	missense	probably damaging	1.00
IGL02861:Manba	APN	3	135570263	missense	probably benign	0.03
IGL02934:Manba	APN	3	135544749	missense	probably benign	0.00
IGL03130:Manba	APN	3	135551159	missense	probably damaging	1.00
IGL03237:Manba	APN	3	135544751	missense	probably damaging	1.00
IGL03342:Manba	APN	3	135517987	missense	possibly damaging	0.51
R0551:Manba	UTSW	3	135517973	missense	probably damaging	0.98
R1549:Manba	UTSW	3	135544806	missense	probably damaging	1.00
R1752:Manba	UTSW	3	135506945	missense	probably damaging	1.00
R1932:Manba	UTSW	3	135544740	missense	probably benign	0.01
R1991:Manba	UTSW	3	135551191	missense	probably benign	0.05
R3729:Manba	UTSW	3	135554850	missense	probably benign	0.00
R3731:Manba	UTSW	3	135554850	missense	probably benign	0.00
R4712:Manba	UTSW	3	135544814	missense	probably damaging	1.00
R5001:Manba	UTSW	3	135567630	missense	probably benign	0.00
R5481:Manba	UTSW	3	135524556	missense	possibly damaging	0.86
R5889:Manba	UTSW	3	135524598	nonsense	probably null
R6033:Manba	UTSW	3	135549261	missense	probably benign	0.00
R6033:Manba	UTSW	3	135549261	missense	probably benign	0.00
R6434:Manba	UTSW	3	135511973	splice site	probably null
R6760:Manba	UTSW	3	135542451	missense	probably damaging	0.98
R7164:Manba	UTSW	3	135542388	missense	probably damaging	1.00
R7182:Manba	UTSW	3	135567513	missense	probably benign	0.06
R7184:Manba	UTSW	3	135523154	missense	possibly damaging	0.62
R7212:Manba	UTSW	3	135567635	missense	probably benign
R7266:Manba	UTSW	3	135517912	missense	probably damaging	1.00
R7271:Manba	UTSW	3	135542376	missense	probably damaging	1.00
R7466:Manba	UTSW	3	135542393	missense	probably benign	0.13
R7467:Manba	UTSW	3	135544801	missense	probably damaging	1.00
R7542:Manba	UTSW	3	135566593	missense	probably benign	0.10
R7546:Manba	UTSW	3	135570246	missense	probably benign	0.01
R7726:Manba	UTSW	3	135518009	missense	probably benign	0.14
R8475:Manba	UTSW	3	135511812	missense	probably benign	0.13
R8768:Manba	UTSW	3	135551234	missense	probably damaging	1.00
R8856:Manba	UTSW	3	135518003	missense	probably damaging	0.98
R9140:Manba	UTSW	3	135485729	missense	probably benign
R9449:Manba	UTSW	3	135549318	missense	probably benign	0.01
Z1176:Manba	UTSW	3	135563274	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTAGCCTTAATCAATGCAAGTCC -3'
(R):5'- TCTCCTTGCGGTAATCTGAC -3'

Sequencing Primer
(F):5'- GCAAGTCCAACACTCTAGTTTATC -3'
(R):5'- GACTCTTCAGGCTCTGCG -3'

Posted On

2015-04-02