Mutagenetix > Incidental Mutation

Incidental Mutation 'R3813:Adamts3'

274142

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3813 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89677926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1018 (D1018G)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: D1017G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D1017G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122551

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163159
AA Change: D1018G

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D1018G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Meta Mutation Damage Score

0.1221

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCCAAAGATAGCATCACTGTGG -3'
(R):5'- ATAATGCAGTGAAGTCCTCCC -3'

Sequencing Primer
(F):5'- AGCATCACTGTGGATTTCAGCAG -3'
(R):5'- CTCAGCAGATAAGAGCTCTTCTGAG -3'

Posted On

2015-04-02