Mutagenetix > Incidental Mutations

Incidental Mutation 'R3813:Cyp2s1'

274147

Institutional Source

Beutler Lab

Gene Symbol

Cyp2s1

Ensembl Gene

ENSMUSG00000040703

Gene Name

cytochrome P450, family 2, subfamily s, polypeptide 1

Synonyms

1200011C15Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25802475-25816913 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 25805866 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]

Predicted Effect

probably null
Transcript: ENSMUST00000043314

SMART Domains

Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:p450	34	493	6.4e-122	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108395

SMART Domains

Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:p450	34	440	4e-108	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152560

Predicted Effect

probably benign
Transcript: ENSMUST00000156714

SMART Domains

Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703

Domain	Start	End	E-Value	Type
Pfam:p450	1	91	1.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206602

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Cyp2s1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Cyp2s1	APN	7	25809258	missense	probably damaging	1.00
IGL02415:Cyp2s1	APN	7	25808137	missense	probably damaging	1.00
IGL02530:Cyp2s1	APN	7	25816424	unclassified	probably benign
IGL02927:Cyp2s1	APN	7	25808152	missense	probably benign	0.17
IGL03358:Cyp2s1	APN	7	25808148	missense	probably damaging	1.00
R0139:Cyp2s1	UTSW	7	25811689	splice site	probably null
R0523:Cyp2s1	UTSW	7	25806050	missense	probably damaging	1.00
R0650:Cyp2s1	UTSW	7	25809258	missense	probably damaging	1.00
R0652:Cyp2s1	UTSW	7	25809258	missense	probably damaging	1.00
R0723:Cyp2s1	UTSW	7	25809548	missense	probably benign	0.01
R1086:Cyp2s1	UTSW	7	25805997	missense	probably damaging	1.00
R3732:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R3732:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R3733:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R3958:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R4593:Cyp2s1	UTSW	7	25816442	unclassified	probably benign
R4965:Cyp2s1	UTSW	7	25809285	missense	possibly damaging	0.85
R5278:Cyp2s1	UTSW	7	25805884	missense	possibly damaging	0.95
R5642:Cyp2s1	UTSW	7	25816319	splice site	probably null
R6258:Cyp2s1	UTSW	7	25816442	unclassified	probably benign
R6628:Cyp2s1	UTSW	7	25815041	missense	probably benign	0.02
R6762:Cyp2s1	UTSW	7	25808070	missense	probably damaging	1.00
R7367:Cyp2s1	UTSW	7	25805973	missense	possibly damaging	0.90
R8145:Cyp2s1	UTSW	7	25808042	critical splice donor site	probably null
R8275:Cyp2s1	UTSW	7	25809310	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CGCAGGATTGGGAATATATCGC -3'
(R):5'- AAAGATCCCAGGGTTCATCCTAC -3'

Sequencing Primer
(F):5'- CTCCAGAGACAGGGATATCA -3'
(R):5'- TGTATTCAGAGCGCGTCC -3'

Posted On

2015-04-02