Mutagenetix > Incidental Mutations

Incidental Mutation 'R3813:Lrriq1'

274156

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103216111 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 260 (E260G)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020043
AA Change: E260G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: E260G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123364
AA Change: E260G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: E260G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166240
AA Change: E260G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: E260G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220380

Meta Mutation Damage Score

0.0713

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGGTAATGATCAGTGGCG -3'
(R):5'- TCCCAGTGAGACCCAAATCTTC -3'

Sequencing Primer
(F):5'- AGTGGGCATGTTCCCTCAGTC -3'
(R):5'- AGCACTTTCACCCGTCAT -3'

Posted On

2015-04-02