Mutagenetix > Incidental Mutations

Incidental Mutation 'R3813:Recql4'

274169

Institutional Source

Beutler Lab

Gene Symbol

Recql4

Ensembl Gene

ENSMUSG00000033762

Gene Name

RecQ protein-like 4

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76703553-76710548 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76704494 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1039 (M1039K)

Ref Sequence

ENSEMBL: ENSMUSP00000155694 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724]

Predicted Effect

probably benign
Transcript: ENSMUST00000019224

SMART Domains

Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

Domain	Start	End	E-Value	Type
Pfam:MFS_1	8	373	3e-16	PFAM
transmembrane domain	388	407	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000023203

SMART Domains

Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

Domain	Start	End	E-Value	Type
Pfam:Aminotran_1_2	83	484	7.8e-35	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036852
AA Change: M1082K

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: M1082K

Domain	Start	End	E-Value	Type
Pfam:Drc1-Sld2	4	132	2.8e-14	PFAM
low complexity region	169	187	N/A	INTRINSIC
low complexity region	368	379	N/A	INTRINSIC
ZnF_C2HC	394	410	5.67e-5	SMART
DEXDc	494	701	5.86e-28	SMART
HELICc	736	831	1.48e-24	SMART
Blast:DEXDc	902	1117	3e-46	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229018

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229098

Predicted Effect

probably benign
Transcript: ENSMUST00000229140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229360

Predicted Effect

probably benign
Transcript: ENSMUST00000229679

Predicted Effect

probably benign
Transcript: ENSMUST00000229734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229856

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230283

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230468

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230482

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230544
AA Change: M1039K

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000230724

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Recql4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Recql4	APN	15	76707336	missense	possibly damaging	0.52
IGL01287:Recql4	APN	15	76709912	splice site	probably benign
IGL01470:Recql4	APN	15	76708944	missense	probably benign	0.40
IGL01809:Recql4	APN	15	76708870	nonsense	probably null
IGL02094:Recql4	APN	15	76709517	missense	probably benign	0.01
IGL02303:Recql4	APN	15	76708571	missense	possibly damaging	0.64
IGL02702:Recql4	APN	15	76707285	missense	probably damaging	1.00
IGL03086:Recql4	APN	15	76706268	missense	probably benign	0.30
IGL03162:Recql4	APN	15	76706096	splice site	probably null
ANU74:Recql4	UTSW	15	76705757	missense	possibly damaging	0.47
F5770:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79
R0688:Recql4	UTSW	15	76709809	unclassified	probably null
R1171:Recql4	UTSW	15	76704039	missense	possibly damaging	0.94
R1348:Recql4	UTSW	15	76709211	missense	probably benign	0.01
R1487:Recql4	UTSW	15	76708983	missense	probably benign	0.11
R1547:Recql4	UTSW	15	76706311	missense	probably damaging	0.99
R1917:Recql4	UTSW	15	76703837	nonsense	probably null
R4066:Recql4	UTSW	15	76705827	missense	probably damaging	1.00
R4363:Recql4	UTSW	15	76706044	missense	probably benign	0.07
R4387:Recql4	UTSW	15	76705958	missense	probably benign	0.00
R4388:Recql4	UTSW	15	76705958	missense	probably benign	0.00
R4700:Recql4	UTSW	15	76708585	missense	probably damaging	1.00
R4701:Recql4	UTSW	15	76708585	missense	probably damaging	1.00
R4923:Recql4	UTSW	15	76710181	missense	probably damaging	1.00
R5075:Recql4	UTSW	15	76709544	missense	probably damaging	1.00
R5103:Recql4	UTSW	15	76706756	missense	probably damaging	1.00
R5226:Recql4	UTSW	15	76710129	missense	probably benign
R5500:Recql4	UTSW	15	76705578	intron	probably benign
R5547:Recql4	UTSW	15	76705794	nonsense	probably null
R5824:Recql4	UTSW	15	76708585	missense	probably damaging	1.00
R5976:Recql4	UTSW	15	76709424	missense	probably benign	0.01
R6086:Recql4	UTSW	15	76704587	missense	probably damaging	0.96
R6756:Recql4	UTSW	15	76704859	missense	probably benign	0.00
R7075:Recql4	UTSW	15	76706424	missense	possibly damaging	0.95
R7086:Recql4	UTSW	15	76705553	missense	unknown
R7449:Recql4	UTSW	15	76705565	missense	unknown
R7653:Recql4	UTSW	15	76703782	missense	probably benign	0.01
V7580:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79
V7581:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79
V7583:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- CCAGGGTCTTCACCTGATTG -3'
(R):5'- GTATGTATGCCCACCACTACCC -3'

Sequencing Primer
(F):5'- GATTGCTGTGCTCCTCATTAGACTG -3'
(R):5'- GCTAGCCAGCTGTTCCC -3'

Posted On

2015-04-02