Mutagenetix > Incidental Mutations

Incidental Mutation 'R3813:Arid2'

274170

Institutional Source

Beutler Lab

Gene Symbol

Arid2

Ensembl Gene

ENSMUSG00000033237

Gene Name

AT rich interactive domain 2 (ARID, RFX-like)

Synonyms

4432409D24Rik, 1700124K17Rik, zipzap/p200

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96287518-96404992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96369950 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 648 (N648S)

Ref Sequence

ENSEMBL: ENSMUSP00000093969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096250]

Predicted Effect

probably benign
Transcript: ENSMUST00000096250
AA Change: N648S

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: N648S

Domain	Start	End	E-Value	Type
ARID	10	101	9.67e-36	SMART
BRIGHT	14	106	3.67e-34	SMART
Pfam:RFX_DNA_binding	521	603	1.7e-26	PFAM
internal_repeat_1	767	843	3.29e-6	PROSPERO
low complexity region	902	942	N/A	INTRINSIC
low complexity region	965	986	N/A	INTRINSIC
low complexity region	1012	1054	N/A	INTRINSIC
low complexity region	1118	1131	N/A	INTRINSIC
internal_repeat_1	1132	1215	3.29e-6	PROSPERO
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1590	1614	N/A	INTRINSIC
ZnF_C2H2	1626	1651	4.34e0	SMART
ZnF_C2H2	1659	1684	4.74e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176739

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Mdga1	G	A	17: 29,838,479	P788S	probably damaging	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Arid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Arid2	APN	15	96372302	missense	probably benign
IGL00321:Arid2	APN	15	96289089	missense	probably damaging	0.97
IGL00434:Arid2	APN	15	96371300	missense	probably damaging	0.99
IGL00576:Arid2	APN	15	96356758	missense	probably damaging	0.99
IGL00766:Arid2	APN	15	96370405	missense	probably benign	0.09
IGL01563:Arid2	APN	15	96372397	missense	probably damaging	0.99
IGL01697:Arid2	APN	15	96361572	critical splice acceptor site	probably null
IGL01845:Arid2	APN	15	96356797	missense	probably damaging	1.00
IGL02159:Arid2	APN	15	96358912	splice site	probably benign
IGL02341:Arid2	APN	15	96372185	missense	probably benign
IGL02416:Arid2	APN	15	96350055	missense	possibly damaging	0.63
IGL02578:Arid2	APN	15	96372235	missense	probably benign	0.00
IGL02598:Arid2	APN	15	96371536	missense	probably damaging	1.00
IGL02644:Arid2	APN	15	96368708	missense	probably damaging	1.00
IGL02653:Arid2	APN	15	96287702	missense	probably damaging	0.99
IGL03115:Arid2	APN	15	96370273	missense	probably damaging	1.00
IGL03137:Arid2	APN	15	96371318	missense	probably benign	0.44
IGL03220:Arid2	APN	15	96361772	missense	probably damaging	0.99
IGL03249:Arid2	APN	15	96401965	missense	probably damaging	1.00
IGL03256:Arid2	APN	15	96370762	missense	probably benign	0.18
IGL03386:Arid2	APN	15	96361574	missense	probably damaging	1.00
H8562:Arid2	UTSW	15	96369546	missense	possibly damaging	0.77
I2288:Arid2	UTSW	15	96369511	missense	possibly damaging	0.95
R0254:Arid2	UTSW	15	96370571	missense	probably damaging	0.97
R0284:Arid2	UTSW	15	96378967	splice site	probably benign
R0347:Arid2	UTSW	15	96370952	missense	probably benign	0.01
R0366:Arid2	UTSW	15	96361720	splice site	probably benign
R0400:Arid2	UTSW	15	96356925	unclassified	probably benign
R0650:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R0651:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R1034:Arid2	UTSW	15	96369505	missense	probably benign	0.01
R1615:Arid2	UTSW	15	96371654	missense	possibly damaging	0.59
R1696:Arid2	UTSW	15	96370183	missense	probably benign	0.01
R2024:Arid2	UTSW	15	96361799	missense	probably damaging	1.00
R2046:Arid2	UTSW	15	96369387	missense	probably damaging	1.00
R2069:Arid2	UTSW	15	96362590	missense	probably damaging	1.00
R2149:Arid2	UTSW	15	96370835	missense	probably damaging	1.00
R2300:Arid2	UTSW	15	96402006	missense	probably damaging	1.00
R2336:Arid2	UTSW	15	96362549	missense	probably damaging	1.00
R2359:Arid2	UTSW	15	96361878	missense	probably damaging	1.00
R2368:Arid2	UTSW	15	96350012	missense	possibly damaging	0.83
R2829:Arid2	UTSW	15	96369454	missense	possibly damaging	0.95
R3013:Arid2	UTSW	15	96361936	missense	probably damaging	1.00
R3109:Arid2	UTSW	15	96356746	missense	probably damaging	1.00
R3765:Arid2	UTSW	15	96370714	missense	probably benign	0.01
R3785:Arid2	UTSW	15	96372558	missense	possibly damaging	0.83
R3811:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3812:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3843:Arid2	UTSW	15	96351840	missense	possibly damaging	0.86
R3978:Arid2	UTSW	15	96363622	missense	probably damaging	1.00
R4279:Arid2	UTSW	15	96371756	missense	probably damaging	1.00
R4569:Arid2	UTSW	15	96392462	missense	probably damaging	1.00
R4597:Arid2	UTSW	15	96370856	missense	probably damaging	1.00
R5020:Arid2	UTSW	15	96371988	missense	probably damaging	0.96
R5154:Arid2	UTSW	15	96401985	missense	probably damaging	1.00
R5303:Arid2	UTSW	15	96392468	missense	probably damaging	1.00
R5620:Arid2	UTSW	15	96372506	missense	probably benign	0.20
R5766:Arid2	UTSW	15	96372205	missense	probably benign	0.01
R6005:Arid2	UTSW	15	96370972	missense	probably benign
R6169:Arid2	UTSW	15	96368677	missense	probably benign	0.36
R6216:Arid2	UTSW	15	96356909	missense	probably benign	0.18
R6392:Arid2	UTSW	15	96361602	missense	probably damaging	0.99
R6430:Arid2	UTSW	15	96363694	missense	probably benign
R6454:Arid2	UTSW	15	96372413	missense	probably benign	0.20
R6672:Arid2	UTSW	15	96362345	missense	probably benign	0.30
R6776:Arid2	UTSW	15	96370949	missense	probably benign	0.00
R6985:Arid2	UTSW	15	96370148	missense	probably benign	0.06
R7132:Arid2	UTSW	15	96350013	missense	possibly damaging	0.67
R7133:Arid2	UTSW	15	96378875	missense	probably damaging	0.99
R7453:Arid2	UTSW	15	96370724	missense	probably benign
R7562:Arid2	UTSW	15	96401968	missense	probably damaging	1.00
R7594:Arid2	UTSW	15	96390994	missense	probably damaging	1.00
R7692:Arid2	UTSW	15	96356697	nonsense	probably null
R7792:Arid2	UTSW	15	96369375	missense	probably benign	0.05
R8036:Arid2	UTSW	15	96368744	missense	probably damaging	1.00
R8094:Arid2	UTSW	15	96368711	missense	possibly damaging	0.86
R8327:Arid2	UTSW	15	96362604	missense	probably damaging	1.00
X0024:Arid2	UTSW	15	96372490	missense	probably benign	0.00
X0066:Arid2	UTSW	15	96356804	missense	probably damaging	1.00
Z1177:Arid2	UTSW	15	96390986	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATAGCCTGGCTCTGTACTTTG -3'
(R):5'- GACTTCACAAGGAATTGGAGC -3'

Sequencing Primer
(F):5'- ACAGTGTTTCTCATGGCTGTC -3'
(R):5'- CACAAGGAATTGGAGCTTTATTCTG -3'

Posted On

2015-04-02