Mutagenetix > Incidental Mutations

Incidental Mutation 'R3813:Mdga1'

274173

Institutional Source

Beutler Lab

Gene Symbol

Mdga1

Ensembl Gene

ENSMUSG00000043557

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 1

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R3813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29827956-29970087 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 29838479 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 788 (P788S)

Ref Sequence

ENSEMBL: ENSMUSP00000126529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073556
AA Change: P780S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: P780S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	741	911	1.02e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165528

Predicted Effect

probably benign
Transcript: ENSMUST00000167190

SMART Domains

Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557

Domain	Start	End	E-Value	Type
low complexity region	236	246	N/A	INTRINSIC
low complexity region	251	265	N/A	INTRINSIC
IGc2	325	389	1.62e-12	SMART
IG	416	510	3.2e-2	SMART
IGc2	527	589	6.25e-14	SMART
IGc2	622	696	3.54e-4	SMART
IGc2	728	795	6.55e-8	SMART
IGc2	825	897	9.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168044
AA Change: P81S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557
AA Change: P81S

Domain	Start	End	E-Value	Type
Pfam:MAM	47	186	3.1e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170786

Predicted Effect

probably damaging
Transcript: ENSMUST00000171691
AA Change: P788S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: P788S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	749	919	3.61e-53	SMART

Meta Mutation Damage Score

0.1392

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,488	R106S	probably benign	Het
Adamts3	T	C	5: 89,677,926	D1018G	possibly damaging	Het
Adgrg1	T	A	8: 95,011,565	L562Q	probably benign	Het
Ankrd11	T	C	8: 122,891,378	T1891A	probably benign	Het
Arid2	A	G	15: 96,369,950	N648S	probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cacna1s	A	T	1: 136,085,347	I312F	probably damaging	Het
Cenpj	A	G	14: 56,553,222	S457P	probably benign	Het
Cep120	G	A	18: 53,740,212		probably benign	Het
Cfap70	T	A	14: 20,421,122	I493L	possibly damaging	Het
Csmd3	T	C	15: 48,791,813	D31G	possibly damaging	Het
Cstf3	T	C	2: 104,609,121	Y54H	probably damaging	Het
Cubn	T	A	2: 13,294,325	Y3179F	probably damaging	Het
Cyp2s1	C	T	7: 25,805,866		probably null	Het
Dll4	C	A	2: 119,331,029	T364N	possibly damaging	Het
Doc2g	C	T	19: 4,004,466		probably null	Het
Etl4	A	G	2: 20,788,435	E657G	probably damaging	Het
Fhdc1	A	G	3: 84,464,270		probably null	Het
Fndc1	T	C	17: 7,773,322	H514R	unknown	Het
Gpat3	A	G	5: 100,891,639		probably benign	Het
H2-Q4	A	G	17: 35,383,095	H311R	possibly damaging	Het
Hipk4	T	C	7: 27,523,947	L144S	probably damaging	Het
Hspa4	G	A	11: 53,270,979	P449S	probably benign	Het
Kif7	A	G	7: 79,713,890	V90A	probably damaging	Het
Klhl38	T	C	15: 58,322,557	I259V	probably benign	Het
Krt9	T	A	11: 100,189,677	E414D	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrriq1	T	C	10: 103,216,111	E260G	probably damaging	Het
Macf1	A	G	4: 123,374,767	S4689P	probably damaging	Het
Manba	G	A	3: 135,563,262	E643K	possibly damaging	Het
Mc3r	T	A	2: 172,248,879	L7Q	probably benign	Het
Olfr1161	T	C	2: 88,024,761	F13S	probably damaging	Het
Olfr814	T	A	10: 129,873,986	Y257F	probably damaging	Het
Pcdh12	G	A	18: 38,283,614	R153*	probably null	Het
Plk3	T	C	4: 117,133,450	Y89C	probably damaging	Het
Prss41	G	A	17: 23,837,622	R160*	probably null	Het
Rae1	T	A	2: 173,006,873		probably benign	Het
Rbm17	T	A	2: 11,595,435		probably benign	Het
Recql4	A	T	15: 76,704,494	M1039K	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slit3	A	G	11: 35,675,979	Y1026C	probably damaging	Het
Tbl2	T	A	5: 135,156,521		probably null	Het
Tex2	G	A	11: 106,511,944	T1034I	unknown	Het
Tmem241	A	T	18: 12,067,110		probably benign	Het
Tmtc1	T	C	6: 148,354,891		probably benign	Het
Trappc9	A	T	15: 73,058,393	I38N	probably damaging	Het
Trmt1	T	A	8: 84,695,217		probably benign	Het
Vps37d	G	A	5: 135,074,450	Q113*	probably null	Het
Zufsp	T	C	10: 33,940,222	E242G	possibly damaging	Het

Other mutations in Mdga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01576:Mdga1	APN	17	29843127	missense	possibly damaging	0.50
IGL01637:Mdga1	APN	17	29839871	missense	probably damaging	1.00
IGL02130:Mdga1	APN	17	29857669	missense	possibly damaging	0.96
IGL02596:Mdga1	APN	17	29832405	splice site	probably benign
IGL03258:Mdga1	APN	17	29839913	missense	probably damaging	1.00
R0184:Mdga1	UTSW	17	29852442	missense	probably damaging	1.00
R0366:Mdga1	UTSW	17	29857708	missense	possibly damaging	0.85
R1017:Mdga1	UTSW	17	29850548	missense	probably damaging	0.98
R1520:Mdga1	UTSW	17	29846519	missense	probably benign	0.12
R1545:Mdga1	UTSW	17	29842902	missense	probably damaging	1.00
R1549:Mdga1	UTSW	17	29837998	missense	probably damaging	1.00
R1671:Mdga1	UTSW	17	29850629	missense	probably damaging	1.00
R1875:Mdga1	UTSW	17	29852607	missense	probably damaging	1.00
R1893:Mdga1	UTSW	17	29849226	missense	probably damaging	1.00
R1958:Mdga1	UTSW	17	29840888	missense	probably damaging	1.00
R1983:Mdga1	UTSW	17	29850605	missense	probably damaging	1.00
R2014:Mdga1	UTSW	17	29849313	missense	probably damaging	1.00
R2894:Mdga1	UTSW	17	29852504	missense	probably damaging	1.00
R2964:Mdga1	UTSW	17	29852468	missense	probably damaging	1.00
R3938:Mdga1	UTSW	17	29857622	missense	probably damaging	1.00
R3982:Mdga1	UTSW	17	29931264	missense	unknown
R4063:Mdga1	UTSW	17	29838031	missense	probably damaging	1.00
R4157:Mdga1	UTSW	17	29833343	missense	probably benign	0.32
R4183:Mdga1	UTSW	17	29969990	missense	unknown
R4392:Mdga1	UTSW	17	29850656	missense	probably damaging	1.00
R4393:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4396:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4806:Mdga1	UTSW	17	29842154	missense	probably benign	0.20
R4829:Mdga1	UTSW	17	29846369	missense	possibly damaging	0.91
R4923:Mdga1	UTSW	17	29838078	missense	probably damaging	0.99
R4932:Mdga1	UTSW	17	29857606	missense	probably damaging	1.00
R5015:Mdga1	UTSW	17	29839873	missense	possibly damaging	0.71
R5076:Mdga1	UTSW	17	29850554	missense	possibly damaging	0.93
R5141:Mdga1	UTSW	17	29852493	missense	probably benign	0.43
R5180:Mdga1	UTSW	17	29857736	splice site	probably benign
R5590:Mdga1	UTSW	17	29839867	missense	probably damaging	1.00
R5747:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R5748:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R6207:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R6826:Mdga1	UTSW	17	29970026	missense	unknown
R6831:Mdga1	UTSW	17	29887516	nonsense	probably null
R7114:Mdga1	UTSW	17	29842842	splice site	probably null
R7147:Mdga1	UTSW	17	29846521	nonsense	probably null
R7273:Mdga1	UTSW	17	29969938	missense	unknown
R7413:Mdga1	UTSW	17	29850673	missense	probably damaging	1.00
R7637:Mdga1	UTSW	17	29832379	missense	probably benign	0.00
R7797:Mdga1	UTSW	17	29842840	splice site	probably null
R7812:Mdga1	UTSW	17	29843141	missense	probably benign	0.02
R7838:Mdga1	UTSW	17	29839822	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGCAAATCAAAGAGCCTTGCAG -3'
(R):5'- AGAAAGGCTGAAGCTGAACCTC -3'

Sequencing Primer
(F):5'- CAGGGCTTAATTCAGAGTTCAGC -3'
(R):5'- GAAGCTGAACCTCATTGTGTCAC -3'

Posted On

2015-04-02