Incidental Mutation 'R3814:Fndc1'
ID274210
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
MMRRC Submission 040769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3814 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7773322 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 514 (H514R)
Ref Sequence ENSEMBL: ENSMUSP00000095036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425]
Predicted Effect unknown
Transcript: ENSMUST00000097425
AA Change: H514R
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: H514R

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,992,919 V4A probably damaging Het
Abca4 C T 3: 122,170,921 probably benign Het
Adam20 G T 8: 40,795,675 W274L probably damaging Het
Cep78 T C 19: 15,981,802 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Cyp2c55 T A 19: 39,007,065 L7Q probably damaging Het
Dnah2 A G 11: 69,492,650 probably null Het
Dpy19l3 G A 7: 35,727,292 Q64* probably null Het
Enthd1 T A 15: 80,452,682 Y517F probably benign Het
G2e3 C T 12: 51,353,661 T32I probably benign Het
Glb1l2 A G 9: 26,771,034 S302P probably benign Het
Ino80d C T 1: 63,074,424 R289Q probably benign Het
Itsn1 T C 16: 91,852,921 L161P possibly damaging Het
Kif19a A G 11: 114,781,919 Y256C probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Map3k5 T C 10: 20,026,190 S328P probably damaging Het
Map3k5 T A 10: 20,140,680 V1339D probably damaging Het
Mib1 G A 18: 10,763,281 V444M probably benign Het
Mon2 T C 10: 123,013,565 I1277V probably damaging Het
Mvp T A 7: 126,987,629 M777L probably benign Het
Pik3c2a G A 7: 116,348,179 R1423W probably damaging Het
Prdm16 T C 4: 154,328,293 E1085G probably damaging Het
Prune1 A C 3: 95,265,439 V105G probably damaging Het
Rbpj G T 5: 53,653,172 E399* probably null Het
Rp1 C A 1: 4,349,708 V394L probably benign Het
S100a4 G A 3: 90,605,845 A83T probably benign Het
Satb1 T C 17: 51,782,907 H304R probably damaging Het
Slc6a17 T C 3: 107,471,317 E680G possibly damaging Het
Tbc1d4 A T 14: 101,458,755 I919N possibly damaging Het
Vmn2r102 A T 17: 19,678,831 K478N probably damaging Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 intron probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
R7359:Fndc1 UTSW 17 7813486 intron probably null
R7731:Fndc1 UTSW 17 7773439 missense unknown
R7743:Fndc1 UTSW 17 7765137 missense unknown
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCCGGCTTTTGTCTCTGAG -3'
(R):5'- GGATTCCCTTGAAGATCCTCG -3'

Sequencing Primer
(F):5'- TCTCTGAGCATGTTAGAAGCCGC -3'
(R):5'- TTCATCACGGTTGGAGACC -3'
Posted On2015-04-02