Incidental Mutation 'R3814:Vmn2r102'
ID274211
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Namevomeronasal 2, receptor 102
SynonymsEG224572
MMRRC Submission 040769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3814 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19660399-19694748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19678831 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 478 (K478N)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
Predicted Effect probably damaging
Transcript: ENSMUST00000171741
AA Change: K478N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: K478N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,992,919 V4A probably damaging Het
Abca4 C T 3: 122,170,921 probably benign Het
Adam20 G T 8: 40,795,675 W274L probably damaging Het
Cep78 T C 19: 15,981,802 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Cyp2c55 T A 19: 39,007,065 L7Q probably damaging Het
Dnah2 A G 11: 69,492,650 probably null Het
Dpy19l3 G A 7: 35,727,292 Q64* probably null Het
Enthd1 T A 15: 80,452,682 Y517F probably benign Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
G2e3 C T 12: 51,353,661 T32I probably benign Het
Glb1l2 A G 9: 26,771,034 S302P probably benign Het
Ino80d C T 1: 63,074,424 R289Q probably benign Het
Itsn1 T C 16: 91,852,921 L161P possibly damaging Het
Kif19a A G 11: 114,781,919 Y256C probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Map3k5 T C 10: 20,026,190 S328P probably damaging Het
Map3k5 T A 10: 20,140,680 V1339D probably damaging Het
Mib1 G A 18: 10,763,281 V444M probably benign Het
Mon2 T C 10: 123,013,565 I1277V probably damaging Het
Mvp T A 7: 126,987,629 M777L probably benign Het
Pik3c2a G A 7: 116,348,179 R1423W probably damaging Het
Prdm16 T C 4: 154,328,293 E1085G probably damaging Het
Prune1 A C 3: 95,265,439 V105G probably damaging Het
Rbpj G T 5: 53,653,172 E399* probably null Het
Rp1 C A 1: 4,349,708 V394L probably benign Het
S100a4 G A 3: 90,605,845 A83T probably benign Het
Satb1 T C 17: 51,782,907 H304R probably damaging Het
Slc6a17 T C 3: 107,471,317 E680G possibly damaging Het
Tbc1d4 A T 14: 101,458,755 I919N possibly damaging Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19678892 missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19677509 missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19678923 splice site probably null
IGL01589:Vmn2r102 APN 17 19678804 missense probably benign
IGL01738:Vmn2r102 APN 17 19677758 missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19660469 missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19693929 missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19681185 missense probably benign
IGL02589:Vmn2r102 APN 17 19681218 missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19677908 missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19694066 missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19694024 missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19676696 missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19660589 missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19677850 missense probably benign 0.00
R0441:Vmn2r102 UTSW 17 19694368 missense probably damaging 1.00
R0583:Vmn2r102 UTSW 17 19676781 missense probably benign 0.01
R0600:Vmn2r102 UTSW 17 19678015 missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19678844 missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R0879:Vmn2r102 UTSW 17 19694192 missense probably damaging 1.00
R1349:Vmn2r102 UTSW 17 19660625 splice site probably benign
R1473:Vmn2r102 UTSW 17 19694581 missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19678770 missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19677508 missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19694493 missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19676744 missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19676687 missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19694668 missense probably damaging 1.00
R3827:Vmn2r102 UTSW 17 19694525 missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19677826 missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19660583 missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19694713 missense probably benign
R4535:Vmn2r102 UTSW 17 19694713 missense probably benign
R4662:Vmn2r102 UTSW 17 19681162 missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19694314 missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19677533 missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19677941 missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19660399 start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19677572 missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R5277:Vmn2r102 UTSW 17 19694131 missense possibly damaging 0.49
R5418:Vmn2r102 UTSW 17 19694153 missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19677542 missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19694681 missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19694140 missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19678745 missense probably benign
R6432:Vmn2r102 UTSW 17 19681221 missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19677907 missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19694188 missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19660432 nonsense probably null
R7009:Vmn2r102 UTSW 17 19694194 missense probably damaging 0.99
R7098:Vmn2r102 UTSW 17 19694408 missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19677487 missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19676624 missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19681143 missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19694101 missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19677831 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATTGTGCACAGTTAAATAC -3'
(R):5'- TGCCAGTGGAGGACTTATTGAAC -3'

Sequencing Primer
(F):5'- CCTGAAGGACACTGAAGT -3'
(R):5'- AGTGTCATGGAATTTGAGTCAAGC -3'
Posted On2015-04-02