Incidental Mutation 'R3814:Cyp2c55'
ID274215
Institutional Source Beutler Lab
Gene Symbol Cyp2c55
Ensembl Gene ENSMUSG00000025002
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms2010318C06Rik
MMRRC Submission 040769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3814 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39007019-39042693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39007065 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 7 (L7Q)
Ref Sequence ENSEMBL: ENSMUSP00000025966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025966]
Predicted Effect probably damaging
Transcript: ENSMUST00000025966
AA Change: L7Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002
AA Change: L7Q

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225458
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,992,919 V4A probably damaging Het
Abca4 C T 3: 122,170,921 probably benign Het
Adam20 G T 8: 40,795,675 W274L probably damaging Het
Cep78 T C 19: 15,981,802 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Dnah2 A G 11: 69,492,650 probably null Het
Dpy19l3 G A 7: 35,727,292 Q64* probably null Het
Enthd1 T A 15: 80,452,682 Y517F probably benign Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
G2e3 C T 12: 51,353,661 T32I probably benign Het
Glb1l2 A G 9: 26,771,034 S302P probably benign Het
Ino80d C T 1: 63,074,424 R289Q probably benign Het
Itsn1 T C 16: 91,852,921 L161P possibly damaging Het
Kif19a A G 11: 114,781,919 Y256C probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Map3k5 T C 10: 20,026,190 S328P probably damaging Het
Map3k5 T A 10: 20,140,680 V1339D probably damaging Het
Mib1 G A 18: 10,763,281 V444M probably benign Het
Mon2 T C 10: 123,013,565 I1277V probably damaging Het
Mvp T A 7: 126,987,629 M777L probably benign Het
Pik3c2a G A 7: 116,348,179 R1423W probably damaging Het
Prdm16 T C 4: 154,328,293 E1085G probably damaging Het
Prune1 A C 3: 95,265,439 V105G probably damaging Het
Rbpj G T 5: 53,653,172 E399* probably null Het
Rp1 C A 1: 4,349,708 V394L probably benign Het
S100a4 G A 3: 90,605,845 A83T probably benign Het
Satb1 T C 17: 51,782,907 H304R probably damaging Het
Slc6a17 T C 3: 107,471,317 E680G possibly damaging Het
Tbc1d4 A T 14: 101,458,755 I919N possibly damaging Het
Vmn2r102 A T 17: 19,678,831 K478N probably damaging Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Other mutations in Cyp2c55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c55 APN 19 39011746 missense probably benign 0.41
IGL00537:Cyp2c55 APN 19 39011706 missense possibly damaging 0.93
IGL00959:Cyp2c55 APN 19 39038143 missense probably benign 0.00
IGL01140:Cyp2c55 APN 19 39018649 missense probably benign
IGL01792:Cyp2c55 APN 19 39042187 missense probably benign
PIT4453001:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R0472:Cyp2c55 UTSW 19 39031379 missense probably benign 0.01
R1452:Cyp2c55 UTSW 19 39011090 missense probably damaging 1.00
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1925:Cyp2c55 UTSW 19 39034377 missense probably benign 0.06
R2154:Cyp2c55 UTSW 19 39034375 missense probably damaging 1.00
R4021:Cyp2c55 UTSW 19 39035434 splice site probably null
R4022:Cyp2c55 UTSW 19 39035434 splice site probably null
R4293:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4294:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4604:Cyp2c55 UTSW 19 39031386 missense possibly damaging 0.82
R4740:Cyp2c55 UTSW 19 39018729 missense probably benign
R4756:Cyp2c55 UTSW 19 39031371 missense probably damaging 1.00
R4879:Cyp2c55 UTSW 19 39042078 frame shift probably null
R5039:Cyp2c55 UTSW 19 39038143 missense probably benign 0.00
R5672:Cyp2c55 UTSW 19 39035546 missense probably benign 0.02
R5834:Cyp2c55 UTSW 19 39042067 missense probably benign 0.00
R6198:Cyp2c55 UTSW 19 39007121 nonsense probably null
R6255:Cyp2c55 UTSW 19 39018667 missense probably benign 0.25
R6431:Cyp2c55 UTSW 19 39031409 missense probably damaging 0.99
R6565:Cyp2c55 UTSW 19 39042122 missense probably benign 0.09
X0062:Cyp2c55 UTSW 19 39018689 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTTTGCTGCAGGCCAGAG -3'
(R):5'- GTGAAAATCCACAGTGCACATTTG -3'

Sequencing Primer
(F):5'- TGCAGGCCAGAGTCCATTCAG -3'
(R):5'- CCCCAGAAATGTACTTATTTAACAGC -3'
Posted On2015-04-02