Mutagenetix > Incidental Mutations

Incidental Mutation 'R3815:Secisbp2l'

274224

Institutional Source

Beutler Lab

Gene Symbol

Secisbp2l

Ensembl Gene

ENSMUSG00000035093

Gene Name

SECIS binding protein 2-like

Synonyms

3110001I20Rik

MMRRC Submission

040770-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.271) question?

Stock #

R3815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125736986-125782870 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125740737 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 933 (G933D)

Ref Sequence

ENSEMBL: ENSMUSP00000055772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053699]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

Domain	Start	End	E-Value	Type
low complexity region	441	459	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	700	802	7.6e-24	PFAM
low complexity region	821	831	N/A	INTRINSIC
low complexity region	970	978	N/A	INTRINSIC
low complexity region	985	996	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139944

SMART Domains

Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

Domain	Start	End	E-Value	Type
low complexity region	67	85	N/A	INTRINSIC
low complexity region	181	194	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	326	427	3.5e-24	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.2%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001L19Rik	A	G	13: 68,611,225	H106R	probably damaging	Het
Aak1	T	C	6: 86,959,042		probably benign	Het
Aldh18a1	A	G	19: 40,570,500	S299P	probably damaging	Het
Als2cr12	T	G	1: 58,659,005	N379T	probably damaging	Het
Ankrd6	A	C	4: 32,806,206	S618R	probably benign	Het
Apobec3	G	T	15: 79,899,100	R126M	possibly damaging	Het
Arl8b	T	A	6: 108,813,697	V65D	probably damaging	Het
AW554918	C	T	18: 25,400,047	R253C	probably benign	Het
Cd177	A	G	7: 24,754,392	V358A	probably benign	Het
Cdca7l	G	A	12: 117,872,213	V95I	probably damaging	Het
Ces1e	A	G	8: 93,201,839		probably null	Het
Coq5	T	G	5: 115,295,898	F306V	probably damaging	Het
Cpsf1	A	G	15: 76,601,149	V501A	probably benign	Het
Csmd1	C	T	8: 16,002,522	A2201T	probably damaging	Het
Cul5	T	A	9: 53,622,943	I630L	probably benign	Het
Cyp4a12b	A	T	4: 115,432,470	D178V	probably damaging	Het
Dedd	A	G	1: 171,338,901	E135G	probably benign	Het
Ecel1	A	G	1: 87,152,900	F368S	probably damaging	Het
Ext1	A	C	15: 53,345,089	I92S	probably benign	Het
Fbxw5	A	T	2: 25,503,564	D268V	possibly damaging	Het
Gen1	A	T	12: 11,252,033	V192E	possibly damaging	Het
Gm11077	T	G	6: 140,729,315	V11G	unknown	Het
Ift88	A	T	14: 57,440,981	E150V	possibly damaging	Het
Kcna1	T	C	6: 126,643,046	R104G	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Krt82	A	G	15: 101,550,600	S2P	probably damaging	Het
Luc7l2	T	C	6: 38,570,591	S69P	possibly damaging	Het
Ly9	G	T	1: 171,589,085	T537N	possibly damaging	Het
Mamstr	G	T	7: 45,644,532	R20L	probably damaging	Het
Nav1	C	A	1: 135,471,124	K573N	possibly damaging	Het
Olfr1457	T	C	19: 13,094,913	H245R	probably damaging	Het
Olfr876	C	T	9: 37,804,169	S86L	probably benign	Het
Olfr889	A	T	9: 38,116,626	T277S	possibly damaging	Het
Olfr922	A	G	9: 38,816,426	K308E	possibly damaging	Het
Palld	T	A	8: 61,549,837		probably benign	Het
Pcdha2	A	G	18: 36,941,695	Y793C	probably benign	Het
Pcdhb4	A	T	18: 37,308,012	D125V	probably damaging	Het
Pomgnt1	T	A	4: 116,153,942		probably null	Het
Ppp1r9b	A	T	11: 94,992,533	E329V	probably damaging	Het
Rarres1	T	A	3: 67,515,321	D32V	probably benign	Het
Rhobtb1	A	G	10: 69,285,693	H53R	possibly damaging	Het
Ryr1	A	T	7: 29,072,902	S2494T	probably damaging	Het
Sapcd2	G	A	2: 25,373,506		probably benign	Het
Senp1	A	C	15: 98,056,832	D490E	probably damaging	Het
Sfrp5	C	T	19: 42,198,791	R280H	probably benign	Het
Skint5	A	G	4: 113,629,122		probably benign	Het
Skint5	G	A	4: 113,846,299	T499I	possibly damaging	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Sorl1	A	G	9: 42,064,049	L487P	possibly damaging	Het
Spire1	G	T	18: 67,506,663	T273K	probably benign	Het
Tep1	T	C	14: 50,868,315	T83A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttn	T	A	2: 76,721,733	R29441*	probably null	Het
Wdr37	A	G	13: 8,853,596		probably benign	Het

Other mutations in Secisbp2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Secisbp2l	APN	2	125743856	missense	probably damaging	0.99
IGL00644:Secisbp2l	APN	2	125743844	missense	probably damaging	1.00
IGL01093:Secisbp2l	APN	2	125740325	missense	probably benign
IGL01621:Secisbp2l	APN	2	125773211	missense	probably benign
IGL01955:Secisbp2l	APN	2	125743812	critical splice donor site	probably null
IGL02036:Secisbp2l	APN	2	125758207	missense	probably benign
IGL02045:Secisbp2l	APN	2	125775578	missense	possibly damaging	0.82
IGL02182:Secisbp2l	APN	2	125747577	missense	probably damaging	1.00
IGL02408:Secisbp2l	APN	2	125740869	nonsense	probably null
IGL02455:Secisbp2l	APN	2	125773478	missense	possibly damaging	0.89
IGL02953:Secisbp2l	APN	2	125760274	missense	probably benign	0.36
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R1415:Secisbp2l	UTSW	2	125740365	missense	probably benign	0.00
R1626:Secisbp2l	UTSW	2	125775686	missense	probably damaging	0.99
R1926:Secisbp2l	UTSW	2	125740677	missense	probably damaging	0.99
R1940:Secisbp2l	UTSW	2	125740339	missense	probably damaging	1.00
R1970:Secisbp2l	UTSW	2	125747510	missense	probably damaging	1.00
R2100:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2240:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2252:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2253:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2472:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2474:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2475:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2990:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2993:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3113:Secisbp2l	UTSW	2	125750286	missense	probably damaging	1.00
R3696:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3750:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3800:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3810:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3812:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3816:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3817:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3880:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4077:Secisbp2l	UTSW	2	125751865	splice site	probably benign
R4096:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4097:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4164:Secisbp2l	UTSW	2	125751883	intron	probably benign
R4332:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4418:Secisbp2l	UTSW	2	125752915	missense	probably benign	0.00
R4598:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4600:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4602:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4603:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4678:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4679:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4684:Secisbp2l	UTSW	2	125745942	missense	probably damaging	1.00
R4741:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4934:Secisbp2l	UTSW	2	125740489	missense	probably damaging	0.99
R5245:Secisbp2l	UTSW	2	125747591	missense	probably damaging	1.00
R5521:Secisbp2l	UTSW	2	125752977	missense	possibly damaging	0.94
R5547:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5630:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5631:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5632:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6378:Secisbp2l	UTSW	2	125768325	missense	possibly damaging	0.78
R6616:Secisbp2l	UTSW	2	125768226	missense	probably damaging	0.96
R6938:Secisbp2l	UTSW	2	125750352	missense	probably damaging	1.00
R7287:Secisbp2l	UTSW	2	125740369	missense	probably benign
R7373:Secisbp2l	UTSW	2	125757271	missense	probably damaging	0.99
R7403:Secisbp2l	UTSW	2	125760279	missense	possibly damaging	0.73
R7484:Secisbp2l	UTSW	2	125771532	nonsense	probably null
R7504:Secisbp2l	UTSW	2	125758171	missense	probably benign	0.30
R7762:Secisbp2l	UTSW	2	125768193	missense	probably damaging	1.00
R7769:Secisbp2l	UTSW	2	125771545	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- CTTGTAGAGACTAACTGGAGGAGC -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- AGCATGGTGGAGACGTCC -3'

Posted On

2015-04-02