Incidental Mutation 'R3815:Secisbp2l'
ID274224
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission 040770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3815 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125740737 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 933 (G933D)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A G 13: 68,611,225 H106R probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Aldh18a1 A G 19: 40,570,500 S299P probably damaging Het
Als2cr12 T G 1: 58,659,005 N379T probably damaging Het
Ankrd6 A C 4: 32,806,206 S618R probably benign Het
Apobec3 G T 15: 79,899,100 R126M possibly damaging Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
AW554918 C T 18: 25,400,047 R253C probably benign Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Cdca7l G A 12: 117,872,213 V95I probably damaging Het
Ces1e A G 8: 93,201,839 probably null Het
Coq5 T G 5: 115,295,898 F306V probably damaging Het
Cpsf1 A G 15: 76,601,149 V501A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cul5 T A 9: 53,622,943 I630L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dedd A G 1: 171,338,901 E135G probably benign Het
Ecel1 A G 1: 87,152,900 F368S probably damaging Het
Ext1 A C 15: 53,345,089 I92S probably benign Het
Fbxw5 A T 2: 25,503,564 D268V possibly damaging Het
Gen1 A T 12: 11,252,033 V192E possibly damaging Het
Gm11077 T G 6: 140,729,315 V11G unknown Het
Ift88 A T 14: 57,440,981 E150V possibly damaging Het
Kcna1 T C 6: 126,643,046 R104G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt82 A G 15: 101,550,600 S2P probably damaging Het
Luc7l2 T C 6: 38,570,591 S69P possibly damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Mamstr G T 7: 45,644,532 R20L probably damaging Het
Nav1 C A 1: 135,471,124 K573N possibly damaging Het
Olfr1457 T C 19: 13,094,913 H245R probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Palld T A 8: 61,549,837 probably benign Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp1r9b A T 11: 94,992,533 E329V probably damaging Het
Rarres1 T A 3: 67,515,321 D32V probably benign Het
Rhobtb1 A G 10: 69,285,693 H53R possibly damaging Het
Ryr1 A T 7: 29,072,902 S2494T probably damaging Het
Sapcd2 G A 2: 25,373,506 probably benign Het
Senp1 A C 15: 98,056,832 D490E probably damaging Het
Sfrp5 C T 19: 42,198,791 R280H probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Skint5 G A 4: 113,846,299 T499I possibly damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Spire1 G T 18: 67,506,663 T273K probably benign Het
Tep1 T C 14: 50,868,315 T83A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttn T A 2: 76,721,733 R29441* probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- CTTGTAGAGACTAACTGGAGGAGC -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- AGCATGGTGGAGACGTCC -3'
Posted On2015-04-02