Mutagenetix > Incidental Mutation

Incidental Mutation 'R3815:Ext1'

274264

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

MMRRC Submission

040770-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53345089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 92 (I92S)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably benign
Transcript: ENSMUST00000077273
AA Change: I92S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: I92S

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Meta Mutation Damage Score

0.0726

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001L19Rik	A	G	13: 68,611,225	H106R	probably damaging	Het
Aak1	T	C	6: 86,959,042		probably benign	Het
Aldh18a1	A	G	19: 40,570,500	S299P	probably damaging	Het
Als2cr12	T	G	1: 58,659,005	N379T	probably damaging	Het
Ankrd6	A	C	4: 32,806,206	S618R	probably benign	Het
Apobec3	G	T	15: 79,899,100	R126M	possibly damaging	Het
Arl8b	T	A	6: 108,813,697	V65D	probably damaging	Het
AW554918	C	T	18: 25,400,047	R253C	probably benign	Het
Cd177	A	G	7: 24,754,392	V358A	probably benign	Het
Cdca7l	G	A	12: 117,872,213	V95I	probably damaging	Het
Ces1e	A	G	8: 93,201,839		probably null	Het
Coq5	T	G	5: 115,295,898	F306V	probably damaging	Het
Cpsf1	A	G	15: 76,601,149	V501A	probably benign	Het
Csmd1	C	T	8: 16,002,522	A2201T	probably damaging	Het
Cul5	T	A	9: 53,622,943	I630L	probably benign	Het
Cyp4a12b	A	T	4: 115,432,470	D178V	probably damaging	Het
Dedd	A	G	1: 171,338,901	E135G	probably benign	Het
Ecel1	A	G	1: 87,152,900	F368S	probably damaging	Het
Fbxw5	A	T	2: 25,503,564	D268V	possibly damaging	Het
Gen1	A	T	12: 11,252,033	V192E	possibly damaging	Het
Gm11077	T	G	6: 140,729,315	V11G	unknown	Het
Ift88	A	T	14: 57,440,981	E150V	possibly damaging	Het
Kcna1	T	C	6: 126,643,046	R104G	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Krt82	A	G	15: 101,550,600	S2P	probably damaging	Het
Luc7l2	T	C	6: 38,570,591	S69P	possibly damaging	Het
Ly9	G	T	1: 171,589,085	T537N	possibly damaging	Het
Mamstr	G	T	7: 45,644,532	R20L	probably damaging	Het
Nav1	C	A	1: 135,471,124	K573N	possibly damaging	Het
Olfr1457	T	C	19: 13,094,913	H245R	probably damaging	Het
Olfr876	C	T	9: 37,804,169	S86L	probably benign	Het
Olfr889	A	T	9: 38,116,626	T277S	possibly damaging	Het
Olfr922	A	G	9: 38,816,426	K308E	possibly damaging	Het
Palld	T	A	8: 61,549,837		probably benign	Het
Pcdha2	A	G	18: 36,941,695	Y793C	probably benign	Het
Pcdhb4	A	T	18: 37,308,012	D125V	probably damaging	Het
Pomgnt1	T	A	4: 116,153,942		probably null	Het
Ppp1r9b	A	T	11: 94,992,533	E329V	probably damaging	Het
Rarres1	T	A	3: 67,515,321	D32V	probably benign	Het
Rhobtb1	A	G	10: 69,285,693	H53R	possibly damaging	Het
Ryr1	A	T	7: 29,072,902	S2494T	probably damaging	Het
Sapcd2	G	A	2: 25,373,506		probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Senp1	A	C	15: 98,056,832	D490E	probably damaging	Het
Sfrp5	C	T	19: 42,198,791	R280H	probably benign	Het
Skint5	A	G	4: 113,629,122		probably benign	Het
Skint5	G	A	4: 113,846,299	T499I	possibly damaging	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Sorl1	A	G	9: 42,064,049	L487P	possibly damaging	Het
Spire1	G	T	18: 67,506,663	T273K	probably benign	Het
Tep1	T	C	14: 50,868,315	T83A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttn	T	A	2: 76,721,733	R29441*	probably null	Het
Wdr37	A	G	13: 8,853,596		probably benign	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTCTCTGTCTAAAGTATCCAGAC -3'
(R):5'- TGCAGTTTAGGGCATCGAGG -3'

Sequencing Primer
(F):5'- CTCTGTCTAAAGTATCCAGACTCAAG -3'
(R):5'- TTTAGGGCATCGAGGAGCCAC -3'

Posted On

2015-04-02