Mutagenetix > Incidental Mutations

Incidental Mutation 'R3815:Spire1'

274271

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

040770-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.255) question?

Stock #

R3815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67506663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 273 (T273K)

Ref Sequence

ENSEMBL: ENSMUSP00000110702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

AlphaFold

Q52KF3

Predicted Effect

probably benign
Transcript: ENSMUST00000045105
AA Change: T260K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: T260K

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000082243
AA Change: T273K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: T273K

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115050
AA Change: T273K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: T273K

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224122

Predicted Effect

probably benign
Transcript: ENSMUST00000224799
AA Change: T190K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.0633

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001L19Rik	A	G	13: 68,611,225	H106R	probably damaging	Het
Aak1	T	C	6: 86,959,042		probably benign	Het
Aldh18a1	A	G	19: 40,570,500	S299P	probably damaging	Het
Als2cr12	T	G	1: 58,659,005	N379T	probably damaging	Het
Ankrd6	A	C	4: 32,806,206	S618R	probably benign	Het
Apobec3	G	T	15: 79,899,100	R126M	possibly damaging	Het
Arl8b	T	A	6: 108,813,697	V65D	probably damaging	Het
AW554918	C	T	18: 25,400,047	R253C	probably benign	Het
Cd177	A	G	7: 24,754,392	V358A	probably benign	Het
Cdca7l	G	A	12: 117,872,213	V95I	probably damaging	Het
Ces1e	A	G	8: 93,201,839		probably null	Het
Coq5	T	G	5: 115,295,898	F306V	probably damaging	Het
Cpsf1	A	G	15: 76,601,149	V501A	probably benign	Het
Csmd1	C	T	8: 16,002,522	A2201T	probably damaging	Het
Cul5	T	A	9: 53,622,943	I630L	probably benign	Het
Cyp4a12b	A	T	4: 115,432,470	D178V	probably damaging	Het
Dedd	A	G	1: 171,338,901	E135G	probably benign	Het
Ecel1	A	G	1: 87,152,900	F368S	probably damaging	Het
Ext1	A	C	15: 53,345,089	I92S	probably benign	Het
Fbxw5	A	T	2: 25,503,564	D268V	possibly damaging	Het
Gen1	A	T	12: 11,252,033	V192E	possibly damaging	Het
Gm11077	T	G	6: 140,729,315	V11G	unknown	Het
Ift88	A	T	14: 57,440,981	E150V	possibly damaging	Het
Kcna1	T	C	6: 126,643,046	R104G	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Krt82	A	G	15: 101,550,600	S2P	probably damaging	Het
Luc7l2	T	C	6: 38,570,591	S69P	possibly damaging	Het
Ly9	G	T	1: 171,589,085	T537N	possibly damaging	Het
Mamstr	G	T	7: 45,644,532	R20L	probably damaging	Het
Nav1	C	A	1: 135,471,124	K573N	possibly damaging	Het
Olfr1457	T	C	19: 13,094,913	H245R	probably damaging	Het
Olfr876	C	T	9: 37,804,169	S86L	probably benign	Het
Olfr889	A	T	9: 38,116,626	T277S	possibly damaging	Het
Olfr922	A	G	9: 38,816,426	K308E	possibly damaging	Het
Palld	T	A	8: 61,549,837		probably benign	Het
Pcdha2	A	G	18: 36,941,695	Y793C	probably benign	Het
Pcdhb4	A	T	18: 37,308,012	D125V	probably damaging	Het
Pomgnt1	T	A	4: 116,153,942		probably null	Het
Ppp1r9b	A	T	11: 94,992,533	E329V	probably damaging	Het
Rarres1	T	A	3: 67,515,321	D32V	probably benign	Het
Rhobtb1	A	G	10: 69,285,693	H53R	possibly damaging	Het
Ryr1	A	T	7: 29,072,902	S2494T	probably damaging	Het
Sapcd2	G	A	2: 25,373,506		probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Senp1	A	C	15: 98,056,832	D490E	probably damaging	Het
Sfrp5	C	T	19: 42,198,791	R280H	probably benign	Het
Skint5	A	G	4: 113,629,122		probably benign	Het
Skint5	G	A	4: 113,846,299	T499I	possibly damaging	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Sorl1	A	G	9: 42,064,049	L487P	possibly damaging	Het
Tep1	T	C	14: 50,868,315	T83A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttn	T	A	2: 76,721,733	R29441*	probably null	Het
Wdr37	A	G	13: 8,853,596		probably benign	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0457:Spire1	UTSW	18	67552600	missense	probably damaging	0.98
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R0608:Spire1	UTSW	18	67528875	missense	probably damaging	0.99
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4050:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	splice site	probably null
R5363:Spire1	UTSW	18	67506555	missense	probably damaging	1.00
R5561:Spire1	UTSW	18	67506646	missense	probably damaging	0.96
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7388:Spire1	UTSW	18	67519880	missense	probably damaging	1.00
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
R8006:Spire1	UTSW	18	67501181	nonsense	probably null
R8111:Spire1	UTSW	18	67519321	missense	probably damaging	0.98
R8675:Spire1	UTSW	18	67491308	missense	possibly damaging	0.48
R8946:Spire1	UTSW	18	67496616	missense	probably damaging	1.00
R9441:Spire1	UTSW	18	67519392	missense	probably benign	0.41
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCTTACCTTCACAGACTGGAAC -3'
(R):5'- TCGCTGTACTGAGCCTTTG -3'

Sequencing Primer
(F):5'- TACCTTCACAGACTGGAACTTAGAG -3'
(R):5'- AGCCTTTGTGTTTTTATTTGTGTGAC -3'

Posted On

2015-04-02