Incidental Mutation 'R3816:Secisbp2l'
ID274284
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission 040881-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R3816 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125740737 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 933 (G933D)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,830,494 I12N probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Abca2 A G 2: 25,446,071 Y2151C probably damaging Het
Adamts3 T A 5: 89,705,264 H509L probably damaging Het
Agfg2 T C 5: 137,653,774 D441G probably benign Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
As3mt A T 19: 46,707,777 D8V probably benign Het
Ass1 G T 2: 31,510,105 probably benign Het
Cdc42bpa A G 1: 180,144,886 I634V possibly damaging Het
Cflar T C 1: 58,752,423 V298A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dlec1 C T 9: 119,124,843 A610V probably damaging Het
Dock1 C T 7: 134,744,286 R186* probably null Het
E130018O15Rik T C 5: 35,382,766 noncoding transcript Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gipc2 T C 3: 152,165,844 K15R probably benign Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Glipr2 G T 4: 43,977,522 A51S possibly damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
H2-M10.2 A T 17: 36,286,362 Y20* probably null Het
Hlcs A G 16: 94,133,088 V242A probably benign Het
Ifi44 T C 3: 151,749,257 I110M possibly damaging Het
Il18r1 T C 1: 40,486,972 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Khk T C 5: 30,926,716 S80P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo1g A G 11: 6,510,926 V706A probably benign Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr700 A G 7: 106,805,820 I214T probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pdgfrb A G 18: 61,078,945 D844G probably damaging Het
Phf3 T C 1: 30,805,753 D1375G probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rac2 T C 15: 78,565,999 D47G possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall1 G T 8: 89,032,675 A267E probably benign Het
Serpina3k A G 12: 104,340,962 E151G probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc51b A G 9: 65,414,018 probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Star G A 8: 25,809,877 M82I probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Usp32 A G 11: 84,994,384 probably null Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vwa3a A G 7: 120,800,379 T1028A probably benign Het
Xrn2 G A 2: 147,028,200 G270R probably damaging Het
Zbbx G T 3: 75,085,495 Q231K probably benign Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
R7762:Secisbp2l UTSW 2 125768193 missense probably damaging 1.00
R7769:Secisbp2l UTSW 2 125771545 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- TGCTTCCTGCTTGTAGAGAC -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- CCTGCTTGTAGAGACTAACTGGAG -3'
Posted On2015-04-02