Incidental Mutation 'R3802:Kank4'
ID274346
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98780133 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 26 (S26P)
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790]
Predicted Effect probably damaging
Transcript: ENSMUST00000102790
AA Change: S26P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: S26P

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0865:Kank4 UTSW 4 98774663 splice site probably benign
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2253:Kank4 UTSW 4 98779226 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4502:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5550:Kank4 UTSW 4 98771441 missense probably benign 0.27
R5667:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Z1176:Kank4 UTSW 4 98778294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTTTTGCTGGGGAGGAAC -3'
(R):5'- AGACGTTGGCCAAATACACATTG -3'

Sequencing Primer
(F):5'- CTGGGGAGGAACAGCATAGGTG -3'
(R):5'- AAGTCCATAGGCTCAGCGG -3'
Posted On2015-04-02