Incidental Mutation 'R3802:Olfr583'
ID274358
Institutional Source Beutler Lab
Gene Symbol Olfr583
Ensembl Gene ENSMUSG00000073960
Gene Nameolfactory receptor 583
SynonymsMOR14-6, GA_x6K02T2PBJ9-5762668-5763618
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103051300-103052259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103052165 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 289 (Y289C)
Ref Sequence ENSEMBL: ENSMUSP00000095812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098211]
Predicted Effect probably benign
Transcript: ENSMUST00000098211
AA Change: Y289C

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095812
Gene: ENSMUSG00000073960
AA Change: Y289C

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 9.1e-107 PFAM
Pfam:7TM_GPCR_Srsx 45 316 1.4e-5 PFAM
Pfam:7tm_1 50 301 9.6e-20 PFAM
Meta Mutation Damage Score 0.1399 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Olfr583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Olfr583 APN 7 103051375 missense probably benign 0.02
IGL02200:Olfr583 APN 7 103051793 missense probably benign
IGL02412:Olfr583 APN 7 103052152 missense probably benign 0.01
IGL02452:Olfr583 APN 7 103051931 missense probably benign 0.00
IGL02859:Olfr583 APN 7 103052138 missense probably benign 0.00
IGL03078:Olfr583 APN 7 103051829 missense probably damaging 1.00
R0675:Olfr583 UTSW 7 103051702 missense probably benign 0.22
R1474:Olfr583 UTSW 7 103052081 missense probably damaging 1.00
R1531:Olfr583 UTSW 7 103051588 missense probably benign 0.00
R1535:Olfr583 UTSW 7 103051369 missense probably benign 0.14
R1777:Olfr583 UTSW 7 103051376 missense probably benign 0.41
R1883:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R1884:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R2265:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2267:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2269:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2299:Olfr583 UTSW 7 103051582 missense probably damaging 0.99
R4239:Olfr583 UTSW 7 103051796 missense probably benign 0.17
R4426:Olfr583 UTSW 7 103051811 missense probably damaging 1.00
R5335:Olfr583 UTSW 7 103051535 missense probably damaging 1.00
R6048:Olfr583 UTSW 7 103051319 missense probably benign 0.00
R6270:Olfr583 UTSW 7 103051331 missense probably benign 0.27
R6837:Olfr583 UTSW 7 103051722 nonsense probably null
R7257:Olfr583 UTSW 7 103051630 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CCACAGGGGTAGATATTCCCTG -3'
(R):5'- TCGAATGGGGAAATCTCCAACC -3'

Sequencing Primer
(F):5'- ACAGGGGTAGATATTCCCTGCATTG -3'
(R):5'- TGGGGAAATCTCCAACCACATTTG -3'
Posted On2015-04-02