Incidental Mutation 'R3802:Nfatc3'
ID274361
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
SynonymsNFATx, NFAT4, D8Ertd281e
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106058840-106130537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106079645 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 374 (Y374C)
Ref Sequence ENSEMBL: ENSMUSP00000148556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
Predicted Effect probably damaging
Transcript: ENSMUST00000109308
AA Change: Y382C

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: Y382C

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211991
AA Change: Y374C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212577
Predicted Effect probably damaging
Transcript: ENSMUST00000212742
AA Change: Y374C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212936
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106099177 missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106127921 missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106078900 missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106108185 missense probably benign 0.29
Struggles UTSW 8 106083870 nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106059973 missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106079203 missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106127942 missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106092195 missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106096196 missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106083854 missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106092160 missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106083834 missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106078850 missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106099136 missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106108455 missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106092144 missense probably damaging 1.00
R3959:Nfatc3 UTSW 8 106099077 nonsense probably null
R4006:Nfatc3 UTSW 8 106108839 missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106079491 missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106079073 missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106108379 missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106079727 missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106108125 missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106079057 missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106079066 missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106096312 missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106083870 nonsense probably null
R6557:Nfatc3 UTSW 8 106119354 missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106083969 missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106119322 missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106108946 missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106079083 missense probably damaging 1.00
R7760:Nfatc3 UTSW 8 106108341 missense possibly damaging 0.66
X0063:Nfatc3 UTSW 8 106083939 missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106108349 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGATACCTGGCTCACTGCTC -3'
(R):5'- TTGCTGAGCCATCTCTCCAG -3'

Sequencing Primer
(F):5'- ACACTGGATCAGGCCTCAG -3'
(R):5'- ATCTCTCCAGCCCCTATCTATTTAC -3'
Posted On2015-04-02