Incidental Mutation 'R3802:Hhipl1'
ID274370
Institutional Source Beutler Lab
Gene Symbol Hhipl1
Ensembl Gene ENSMUSG00000021260
Gene Namehedgehog interacting protein-like 1
Synonyms
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108306270-108330869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108312307 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 298 (E298G)
Ref Sequence ENSEMBL: ENSMUSP00000021685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021685]
Predicted Effect probably benign
Transcript: ENSMUST00000021685
AA Change: E298G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021685
Gene: ENSMUSG00000021260
AA Change: E298G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Folate_rec 28 189 2.4e-21 PFAM
Pfam:GSDH 199 532 3e-39 PFAM
low complexity region 619 670 N/A INTRINSIC
SR 682 785 2.01e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223395
Meta Mutation Damage Score 0.1061 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glucose/sorbosone dehydrogenase family. The encoded protein also contains a domain that binds folate and reduced folic acid derivatives. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Hhipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
lemon_drops UTSW 12 108311944 missense probably damaging 1.00
Rock_candy UTSW 12 108311689 missense probably damaging 1.00
R0091:Hhipl1 UTSW 12 108321897 splice site probably benign
R0180:Hhipl1 UTSW 12 108328070 missense probably damaging 1.00
R0610:Hhipl1 UTSW 12 108319402 nonsense probably null
R0962:Hhipl1 UTSW 12 108327721 missense probably benign 0.02
R1170:Hhipl1 UTSW 12 108311693 nonsense probably null
R1474:Hhipl1 UTSW 12 108311737 missense probably damaging 1.00
R1878:Hhipl1 UTSW 12 108320060 missense possibly damaging 0.93
R2001:Hhipl1 UTSW 12 108321859 missense possibly damaging 0.90
R2103:Hhipl1 UTSW 12 108327718 missense probably benign 0.04
R2132:Hhipl1 UTSW 12 108311690 missense probably damaging 1.00
R2342:Hhipl1 UTSW 12 108318462 missense probably damaging 1.00
R2408:Hhipl1 UTSW 12 108318547 missense probably benign 0.05
R3431:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3432:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3741:Hhipl1 UTSW 12 108318717 missense probably damaging 1.00
R4744:Hhipl1 UTSW 12 108319979 missense possibly damaging 0.95
R4760:Hhipl1 UTSW 12 108320077 missense probably damaging 0.99
R4927:Hhipl1 UTSW 12 108311944 missense probably damaging 1.00
R5206:Hhipl1 UTSW 12 108312178 missense probably damaging 1.00
R5244:Hhipl1 UTSW 12 108312134 missense probably damaging 0.99
R5292:Hhipl1 UTSW 12 108327778 missense probably benign
R5445:Hhipl1 UTSW 12 108328208 missense probably damaging 0.97
R6248:Hhipl1 UTSW 12 108318705 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCCTTCCTGAATGTGAGC -3'
(R):5'- TTTTGCAAAATCACTCCTCCCAGG -3'

Sequencing Primer
(F):5'- TTCCTGAATGTGAGCCAAGC -3'
(R):5'- GCCACAGAGCATGGGATTCAC -3'
Posted On2015-04-02