Incidental Mutation 'R3802:4930452B06Rik'
ID274374
Institutional Source Beutler Lab
Gene Symbol 4930452B06Rik
Ensembl Gene ENSMUSG00000021747
Gene NameRIKEN cDNA 4930452B06 gene
Synonyms
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8431192-8666240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8510931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 494 (D494E)
Ref Sequence ENSEMBL: ENSMUSP00000100061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102996]
Predicted Effect probably benign
Transcript: ENSMUST00000102996
AA Change: D494E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100061
Gene: ENSMUSG00000021747
AA Change: D494E

DomainStartEndE-ValueType
Pfam:DUF667 1 188 1.7e-43 PFAM
low complexity region 344 358 N/A INTRINSIC
low complexity region 506 519 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225744
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in 4930452B06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:4930452B06Rik APN 14 8473370 missense possibly damaging 0.57
IGL02010:4930452B06Rik APN 14 8578384 missense possibly damaging 0.68
IGL02385:4930452B06Rik APN 14 8510920 missense possibly damaging 0.59
IGL02431:4930452B06Rik APN 14 8659424 missense probably damaging 1.00
IGL02723:4930452B06Rik APN 14 8516507 missense probably benign 0.02
IGL02865:4930452B06Rik APN 14 8517940 missense probably benign 0.00
IGL03030:4930452B06Rik APN 14 8511113 missense probably damaging 1.00
IGL03204:4930452B06Rik APN 14 8644436 missense possibly damaging 0.68
IGL03014:4930452B06Rik UTSW 14 8431608 makesense probably null
R0197:4930452B06Rik UTSW 14 8518695 missense probably damaging 1.00
R0265:4930452B06Rik UTSW 14 8431667 missense probably damaging 1.00
R0513:4930452B06Rik UTSW 14 8536609 missense probably damaging 1.00
R0647:4930452B06Rik UTSW 14 8536655 missense possibly damaging 0.94
R1168:4930452B06Rik UTSW 14 8442939 missense probably benign 0.22
R1610:4930452B06Rik UTSW 14 8511110 missense probably benign 0.00
R1625:4930452B06Rik UTSW 14 8431668 missense probably damaging 1.00
R2010:4930452B06Rik UTSW 14 8511021 missense probably damaging 1.00
R2084:4930452B06Rik UTSW 14 8558171 missense probably damaging 1.00
R2174:4930452B06Rik UTSW 14 8558109 missense probably benign 0.02
R4244:4930452B06Rik UTSW 14 8482521 missense probably benign 0.00
R4471:4930452B06Rik UTSW 14 8536571 missense probably damaging 1.00
R4516:4930452B06Rik UTSW 14 8536609 missense probably damaging 1.00
R4824:4930452B06Rik UTSW 14 8665997 start codon destroyed probably null 0.93
R4884:4930452B06Rik UTSW 14 8578394 missense probably damaging 0.97
R4975:4930452B06Rik UTSW 14 8518736 missense probably benign 0.00
R5455:4930452B06Rik UTSW 14 8536516 critical splice donor site probably null
R6280:4930452B06Rik UTSW 14 8473414 critical splice acceptor site probably null
R6438:4930452B06Rik UTSW 14 8431701 missense probably damaging 0.98
R6639:4930452B06Rik UTSW 14 8536530 missense probably benign 0.12
R7101:4930452B06Rik UTSW 14 8511171 missense possibly damaging 0.75
R7456:4930452B06Rik UTSW 14 8442933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTTACCATAACAACCGGATGGG -3'
(R):5'- TCGAACCTGTGGCTAGAAACC -3'

Sequencing Primer
(F):5'- GACTGTTGACTGACACAGCAATCTG -3'
(R):5'- CCTGTGGCTAGAAACCAGCAAG -3'
Posted On2015-04-02