Incidental Mutation 'R3802:H2-Ke6'
ID274377
Institutional Source Beutler Lab
Gene Symbol H2-Ke6
Ensembl Gene ENSMUSG00000073422
Gene NameH2-K region expressed gene 6
SynonymsRing2, H-2Ke6
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34026033-34028060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34026467 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 231 (V231E)
Ref Sequence ENSEMBL: ENSMUSP00000038069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000025186] [ENSMUST00000045467] [ENSMUST00000114303] [ENSMUST00000169397] [ENSMUST00000171872]
Predicted Effect probably benign
Transcript: ENSMUST00000025183
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045467
AA Change: V231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422
AA Change: V231E

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083621
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect probably benign
Transcript: ENSMUST00000171872
SMART Domains Protein: ENSMUSP00000133146
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 246 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199860
Meta Mutation Damage Score 0.6994 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mice, the Ke6 protein is a 17-beta-hydroxysteroid dehydrogenase that can regulate the concentration of biologically active estrogens and androgens. It is preferentially an oxidative enzyme and inactivates estradiol, testosterone, and dihydrotestosterone. However, the enzyme has some reductive activity and can synthesize estradiol from estrone. The protein encoded by this gene is similar to Ke6 and is a member of the short-chain dehydrogenase superfamily. An alternatively spliced transcript of this gene has been detected, but the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in H2-Ke6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:H2-Ke6 APN 17 34026861 missense probably damaging 0.97
R1419:H2-Ke6 UTSW 17 34027643 missense probably benign 0.01
R1565:H2-Ke6 UTSW 17 34027495 missense possibly damaging 0.87
R2017:H2-Ke6 UTSW 17 34026213 missense probably damaging 0.96
R3803:H2-Ke6 UTSW 17 34026467 missense probably damaging 1.00
R4988:H2-Ke6 UTSW 17 34027288 missense probably damaging 1.00
R5081:H2-Ke6 UTSW 17 34027578 unclassified probably benign
R5164:H2-Ke6 UTSW 17 34026978 unclassified probably benign
R5447:H2-Ke6 UTSW 17 34026912 missense probably damaging 1.00
R5475:H2-Ke6 UTSW 17 34027313 unclassified probably benign
R5667:H2-Ke6 UTSW 17 34026461 missense probably null 1.00
R5671:H2-Ke6 UTSW 17 34026461 missense probably null 1.00
R6052:H2-Ke6 UTSW 17 34027455 missense probably damaging 1.00
R6833:H2-Ke6 UTSW 17 34027217 missense probably damaging 1.00
R6834:H2-Ke6 UTSW 17 34027217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAAGGGATGTCTGCTCTGC -3'
(R):5'- ATGATTCCGTTGGGACACATGG -3'

Sequencing Primer
(F):5'- AAGGCCTCATACCACTGA -3'
(R):5'- GGTCGCACAGGGATTAAT -3'
Posted On2015-04-02