Incidental Mutation 'R3803:Als2'
ID 274390
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Name alsin Rho guanine nucleotide exchange factor
Synonyms 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock # R3803 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 59162926-59237231 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 59167199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 1634 (M1634R)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000114275] [ENSMUST00000163058]
AlphaFold Q920R0
Predicted Effect probably damaging
Transcript: ENSMUST00000027178
AA Change: M1634R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: M1634R

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114275
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163058
AA Change: M1634R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: M1634R

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190598
Meta Mutation Damage Score 0.8491 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8478:Als2 UTSW 1 59186016 missense probably damaging 0.96
R8492:Als2 UTSW 1 59211344 missense probably damaging 0.98
R9048:Als2 UTSW 1 59186511 missense possibly damaging 0.81
R9090:Als2 UTSW 1 59203030 missense probably benign 0.01
R9128:Als2 UTSW 1 59180550 missense probably benign 0.00
R9206:Als2 UTSW 1 59185247 missense probably damaging 1.00
R9271:Als2 UTSW 1 59203030 missense probably benign 0.01
R9430:Als2 UTSW 1 59192039 missense probably benign 0.00
R9455:Als2 UTSW 1 59180137 missense probably damaging 1.00
R9482:Als2 UTSW 1 59191950 missense probably damaging 1.00
R9494:Als2 UTSW 1 59167505 missense probably damaging 1.00
R9544:Als2 UTSW 1 59211309 missense probably benign 0.00
R9796:Als2 UTSW 1 59170442 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGCCAGCTTGGAAATAAACC -3'
(R):5'- TGCTGCTCCTGTCAGAATAG -3'

Sequencing Primer
(F):5'- GCTTGGAAATAAACCATCCCTC -3'
(R):5'- GCTGCTCCTGTCAGAATAGAATGTC -3'
Posted On 2015-04-02