Incidental Mutation 'R3803:Kdm5b'
ID 274392
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 040878-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R3803 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134543679 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 783 (I783V)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000047714
AA Change: I783V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: I783V

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
AA Change: I783V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: I783V

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,522,033 (GRCm39) N1263S probably benign Het
Alpk1 A C 3: 127,473,486 (GRCm39) V839G possibly damaging Het
Als2 A C 1: 59,206,358 (GRCm39) M1634R probably damaging Het
Aox1 T A 1: 58,329,058 (GRCm39) probably null Het
Aqp12 C T 1: 92,934,088 (GRCm39) probably benign Het
Arhgap24 T C 5: 103,040,308 (GRCm39) V508A probably damaging Het
Arhgap9 T A 10: 127,165,386 (GRCm39) D598E possibly damaging Het
Btaf1 A T 19: 36,966,373 (GRCm39) H1047L probably benign Het
Btaf1 A T 19: 36,963,948 (GRCm39) T840S probably benign Het
Capn13 G A 17: 73,646,396 (GRCm39) P339L probably benign Het
Clstn1 A G 4: 149,719,796 (GRCm39) H437R probably damaging Het
Col1a1 A G 11: 94,828,895 (GRCm39) E79G unknown Het
Cspp1 C A 1: 10,196,598 (GRCm39) D157E probably damaging Het
Cyp4f16 T C 17: 32,763,858 (GRCm39) S217P possibly damaging Het
Ddx50 C A 10: 62,475,723 (GRCm39) V333F probably damaging Het
Dnai2 A G 11: 114,629,551 (GRCm39) S193G probably benign Het
Dync2h1 A T 9: 6,935,293 (GRCm39) H4236Q probably benign Het
Emc1 T C 4: 139,094,474 (GRCm39) Y676H possibly damaging Het
Erich6 T A 3: 58,528,753 (GRCm39) Y499F probably damaging Het
Fa2h A G 8: 112,082,030 (GRCm39) probably null Het
Fads2b A T 2: 85,338,682 (GRCm39) probably null Het
Gli1 T A 10: 127,173,934 (GRCm39) probably benign Het
Gm14403 A G 2: 177,200,569 (GRCm39) S172G probably benign Het
Grhl1 C T 12: 24,634,918 (GRCm39) T330M probably damaging Het
Grm8 T G 6: 28,125,635 (GRCm39) N164H possibly damaging Het
Gstm3 G A 3: 107,871,551 (GRCm39) T210I probably benign Het
Helz2 A G 2: 180,881,789 (GRCm39) F335L probably damaging Het
Hr G A 14: 70,795,333 (GRCm39) A322T probably benign Het
Hsd17b8 A T 17: 34,245,441 (GRCm39) V231E probably damaging Het
Iapp A G 6: 142,249,151 (GRCm39) N68S probably benign Het
Kctd4 A T 14: 76,200,726 (GRCm39) L232F probably benign Het
Larp4b T A 13: 9,208,590 (GRCm39) N414K probably benign Het
Ldb2 T C 5: 44,630,736 (GRCm39) E337G probably benign Het
Lgr4 A G 2: 109,838,542 (GRCm39) K498E probably benign Het
Lipo3 C T 19: 33,762,257 (GRCm39) C80Y probably damaging Het
Luc7l3 A T 11: 94,183,992 (GRCm39) probably benign Het
Ndrg2 C A 14: 52,148,132 (GRCm39) probably null Het
Ndufaf3 C A 9: 108,444,092 (GRCm39) R12L probably benign Het
Nol4 A T 18: 22,828,012 (GRCm39) L634I probably damaging Het
Npr3 C T 15: 11,895,876 (GRCm39) A257T probably damaging Het
Nrg3 G A 14: 38,098,391 (GRCm39) P496S probably damaging Het
Or4g17 A T 2: 111,209,638 (GRCm39) M98L possibly damaging Het
Or51a7 T C 7: 102,615,228 (GRCm39) probably null Het
Pak3 G A X: 142,492,727 (GRCm39) V87I probably damaging Het
Pclo C T 5: 14,565,416 (GRCm39) Q61* probably null Het
Phf19 A G 2: 34,789,670 (GRCm39) L350P probably damaging Het
Phf8 T C X: 150,355,572 (GRCm39) S512P possibly damaging Het
Pkhd1l1 T C 15: 44,356,531 (GRCm39) L332P probably benign Het
Prpf4b T C 13: 35,067,665 (GRCm39) probably benign Het
Rgl3 A G 9: 21,887,321 (GRCm39) I500T probably damaging Het
Rgs7 T A 1: 175,016,785 (GRCm39) I62F probably benign Het
Rttn A G 18: 88,995,831 (GRCm39) N205D probably damaging Het
Samd8 G A 14: 21,825,133 (GRCm39) V30M probably damaging Het
Scn7a G A 2: 66,510,590 (GRCm39) Q1271* probably null Het
Skor1 A G 9: 63,052,868 (GRCm39) V339A probably benign Het
Slc16a10 G C 10: 39,932,620 (GRCm39) H314D possibly damaging Het
Slc5a6 T C 5: 31,200,295 (GRCm39) E130G probably damaging Het
Sorcs2 T A 5: 36,555,150 (GRCm39) K80N probably benign Het
Stc1 T C 14: 69,275,924 (GRCm39) I239T probably benign Het
Steap4 G T 5: 8,026,979 (GRCm39) R314L probably damaging Het
Suclg2 A T 6: 95,474,649 (GRCm39) I372N probably damaging Het
Trav7d-4 A T 14: 53,007,575 (GRCm39) K23* probably null Het
Ttn A G 2: 76,641,075 (GRCm39) L13598P probably damaging Het
Vmn2r52 A G 7: 9,907,439 (GRCm39) S96P probably damaging Het
Wdr25 T C 12: 108,864,479 (GRCm39) V208A probably damaging Het
Wdr27 C T 17: 15,138,371 (GRCm39) V360M probably benign Het
Zfp54 T C 17: 21,653,814 (GRCm39) C103R possibly damaging Het
Zfp618 A G 4: 63,051,256 (GRCm39) E679G probably damaging Het
Zfp846 A G 9: 20,505,735 (GRCm39) I532V probably benign Het
Zkscan2 A T 7: 123,094,365 (GRCm39) probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGTACCCTTTGTCAGACTATTCCC -3'
(R):5'- AAGCCATGAAGACACGTGC -3'

Sequencing Primer
(F):5'- GTCAGACTATTCCCCATCCCC -3'
(R):5'- GACACGTGCATTCATTACTCGGAG -3'
Posted On 2015-04-02