Incidental Mutation 'R3803:Alpk1'
ID274404
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Namealpha-kinase 1
Synonyms8430410J10Rik
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location127670310-127780527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 127679837 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 839 (V839G)
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029662
AA Change: V839G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: V839G

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect possibly damaging
Transcript: ENSMUST00000198955
AA Change: V839G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: V839G

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Meta Mutation Damage Score 0.4138 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 unclassified probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3927:Alpk1 UTSW 3 127677716 missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127685320 splice site probably benign
R5169:Alpk1 UTSW 3 127671101 missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R5940:Alpk1 UTSW 3 127670946 missense probably benign
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127684375 nonsense probably null
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
R8029:Alpk1 UTSW 3 127729285 missense possibly damaging 0.95
Z1176:Alpk1 UTSW 3 127673438 missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127685307 missense
Predicted Primers PCR Primer
(F):5'- CCATGGTGAGTATGAGCTGG -3'
(R):5'- CAGACGATGGACTATCACCCTC -3'

Sequencing Primer
(F):5'- GCTCTTCAGCATGCTCCCAAG -3'
(R):5'- GATGGACTATCACCCTCTCAGGTAG -3'
Posted On2015-04-02