Incidental Mutation 'R3803:Vmn2r52'
ID274420
Institutional Source Beutler Lab
Gene Symbol Vmn2r52
Ensembl Gene ENSMUSG00000091930
Gene Namevomeronasal 2, receptor 52
SynonymsEG384534
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10158652-10176286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10173512 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 96 (S96P)
Ref Sequence ENSEMBL: ENSMUSP00000129352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164918]
Predicted Effect probably damaging
Transcript: ENSMUST00000164918
AA Change: S96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129352
Gene: ENSMUSG00000091930
AA Change: S96P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 8.1e-29 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 596 833 1.1e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Vmn2r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r52 APN 7 10169096 missense probably benign 0.30
IGL00328:Vmn2r52 APN 7 10171417 missense probably benign 0.12
IGL00980:Vmn2r52 APN 7 10171090 missense probably damaging 1.00
IGL01468:Vmn2r52 APN 7 10158941 missense probably damaging 1.00
IGL01660:Vmn2r52 APN 7 10159180 missense probably damaging 0.97
IGL02215:Vmn2r52 APN 7 10171102 missense probably damaging 0.97
IGL03030:Vmn2r52 APN 7 10158872 missense probably benign 0.12
IGL03212:Vmn2r52 APN 7 10159547 missense possibly damaging 0.47
FR4589:Vmn2r52 UTSW 7 10159020 missense probably damaging 0.97
PIT4283001:Vmn2r52 UTSW 7 10170829 missense possibly damaging 0.89
R0184:Vmn2r52 UTSW 7 10159338 missense probably damaging 1.00
R0190:Vmn2r52 UTSW 7 10171388 missense probably benign 0.00
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0257:Vmn2r52 UTSW 7 10171055 nonsense probably null
R0310:Vmn2r52 UTSW 7 10159466 missense probably damaging 1.00
R1831:Vmn2r52 UTSW 7 10159488 missense probably damaging 1.00
R1862:Vmn2r52 UTSW 7 10173406 missense possibly damaging 0.94
R2484:Vmn2r52 UTSW 7 10169131 missense probably damaging 0.96
R2510:Vmn2r52 UTSW 7 10170868 missense probably benign
R3625:Vmn2r52 UTSW 7 10159178 missense probably damaging 1.00
R4013:Vmn2r52 UTSW 7 10170676 missense probably benign 0.00
R4283:Vmn2r52 UTSW 7 10170638 missense possibly damaging 0.60
R4324:Vmn2r52 UTSW 7 10171013 missense possibly damaging 0.94
R4578:Vmn2r52 UTSW 7 10170690 missense probably damaging 1.00
R4806:Vmn2r52 UTSW 7 10159242 missense probably damaging 1.00
R5083:Vmn2r52 UTSW 7 10159465 nonsense probably null
R5249:Vmn2r52 UTSW 7 10176270 missense probably benign
R5306:Vmn2r52 UTSW 7 10170745 missense possibly damaging 0.88
R5332:Vmn2r52 UTSW 7 10169125 missense probably benign 0.17
R5617:Vmn2r52 UTSW 7 10170934 missense probably damaging 0.99
R5643:Vmn2r52 UTSW 7 10171132 missense probably damaging 1.00
R5749:Vmn2r52 UTSW 7 10159032 missense probably damaging 1.00
R5763:Vmn2r52 UTSW 7 10171304 missense probably benign 0.01
R6103:Vmn2r52 UTSW 7 10171400 missense probably benign 0.36
R6148:Vmn2r52 UTSW 7 10171163 missense probably benign 0.00
R6356:Vmn2r52 UTSW 7 10168999 missense probably benign 0.01
R6412:Vmn2r52 UTSW 7 10171009 missense probably benign
R6657:Vmn2r52 UTSW 7 10159163 missense probably damaging 0.99
R6997:Vmn2r52 UTSW 7 10169071 missense probably benign 0.06
R7395:Vmn2r52 UTSW 7 10170817 missense probably benign 0.00
R7621:Vmn2r52 UTSW 7 10173347 missense probably benign 0.00
R7691:Vmn2r52 UTSW 7 10159182 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCTATGATAACTCACATGTGG -3'
(R):5'- CAGAAACATCCAGTACAGTATAGTGC -3'

Sequencing Primer
(F):5'- TCACATGTGGAGATAAGAAAATGTCC -3'
(R):5'- TCCAGTACAGTATAGTGCTTCTATTG -3'
Posted On2015-04-02