Incidental Mutation 'R3803:Rgl3'
ID274427
Institutional Source Beutler Lab
Gene Symbol Rgl3
Ensembl Gene ENSMUSG00000040146
Gene Nameral guanine nucleotide dissociation stimulator-like 3
Synonyms1300003D20Rik
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21968711-21989446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21976025 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 500 (I500T)
Ref Sequence ENSEMBL: ENSMUSP00000148965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045726] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably damaging
Transcript: ENSMUST00000045726
AA Change: I500T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146
AA Change: I500T

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213558
Predicted Effect probably damaging
Transcript: ENSMUST00000214026
AA Change: I500T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Meta Mutation Damage Score 0.1497 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Rgl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rgl3 APN 9 21977239 missense probably damaging 1.00
IGL00770:Rgl3 APN 9 21987722 splice site probably benign
IGL00774:Rgl3 APN 9 21987722 splice site probably benign
IGL02071:Rgl3 APN 9 21988263 missense probably benign 0.00
IGL02172:Rgl3 APN 9 21976838 missense probably damaging 1.00
IGL02190:Rgl3 APN 9 21981708 missense probably benign 0.00
IGL02277:Rgl3 APN 9 21974109 missense probably damaging 1.00
IGL02515:Rgl3 APN 9 21974100 missense possibly damaging 0.93
R0077:Rgl3 UTSW 9 21974102 missense probably benign 0.00
R0126:Rgl3 UTSW 9 21975812 missense probably benign 0.06
R0360:Rgl3 UTSW 9 21976857 missense probably damaging 0.97
R0421:Rgl3 UTSW 9 21976032 missense probably benign 0.06
R0556:Rgl3 UTSW 9 21975844 nonsense probably null
R0751:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1184:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1548:Rgl3 UTSW 9 21980706 missense probably benign 0.11
R2176:Rgl3 UTSW 9 21975958 utr 3 prime probably benign
R3154:Rgl3 UTSW 9 21980774 missense probably damaging 1.00
R3607:Rgl3 UTSW 9 21987691 missense probably damaging 0.98
R3958:Rgl3 UTSW 9 21975589 intron probably benign
R4081:Rgl3 UTSW 9 21987675 missense possibly damaging 0.79
R4937:Rgl3 UTSW 9 21987708 nonsense probably null
R5068:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5070:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5217:Rgl3 UTSW 9 21987648 makesense probably null
R5772:Rgl3 UTSW 9 21981612 missense probably benign 0.00
R5819:Rgl3 UTSW 9 21981602 critical splice donor site probably null
R6509:Rgl3 UTSW 9 21971908 missense probably benign 0.00
R7425:Rgl3 UTSW 9 21976827 nonsense probably null
R7744:Rgl3 UTSW 9 21987570 missense probably benign 0.00
R7883:Rgl3 UTSW 9 21981427 missense probably benign 0.00
R7966:Rgl3 UTSW 9 21981427 missense probably benign 0.00
X0019:Rgl3 UTSW 9 21981479 missense probably benign
Z1176:Rgl3 UTSW 9 21981403 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGAGATGAGTTCTTCTCTCGG -3'
(R):5'- CTGTGAATGTTTTGCACCCC -3'

Sequencing Primer
(F):5'- ATGAGTTCTTCTCTCGGGACAGC -3'
(R):5'- GTGAATGTTTTGCACCCCACTAAC -3'
Posted On2015-04-02