Incidental Mutation 'R3803:Ndufaf3'
ID274429
Institutional Source Beutler Lab
Gene Symbol Ndufaf3
Ensembl Gene ENSMUSG00000070283
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3
Synonyms4733401H18Rik
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108565537-108567434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108566893 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 12 (R12L)
Ref Sequence ENSEMBL: ENSMUSP00000073832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019183] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000193421] [ENSMUST00000193427] [ENSMUST00000194381] [ENSMUST00000194904] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074208
AA Change: R12L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283
AA Change: R12L

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081111
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect probably benign
Transcript: ENSMUST00000193421
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect probably benign
Transcript: ENSMUST00000194904
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Meta Mutation Damage Score 0.2382 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Ndufaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ndufaf3 APN 9 108566869 missense probably benign 0.27
R0594:Ndufaf3 UTSW 9 108566923 missense probably benign 0.01
R1295:Ndufaf3 UTSW 9 108566693 missense probably damaging 1.00
R1782:Ndufaf3 UTSW 9 108566011 missense probably damaging 1.00
R2125:Ndufaf3 UTSW 9 108566737 missense probably benign 0.16
R5470:Ndufaf3 UTSW 9 108566444 unclassified probably benign
R6601:Ndufaf3 UTSW 9 108566217 missense probably benign 0.01
R7396:Ndufaf3 UTSW 9 108566603 missense probably damaging 0.96
R7454:Ndufaf3 UTSW 9 108566926 start codon destroyed probably null 0.69
Predicted Primers PCR Primer
(F):5'- TATAACTCATCGTCCGCCGG -3'
(R):5'- TGAGAATCCCAGGAACAGGC -3'

Sequencing Primer
(F):5'- TCATCGTCCGCCGGAGAAAG -3'
(R):5'- GTGGCCTAAACAATACCCTTAGG -3'
Posted On2015-04-02