Incidental Mutation 'R3803:Ddx50'
ID274432
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 50
SynonymsGU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62615895-62651218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 62639944 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 333 (V333F)
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
Predicted Effect probably damaging
Transcript: ENSMUST00000020270
AA Change: V333F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: V333F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219076
Meta Mutation Damage Score 0.2869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62647132 missense probably benign
IGL01955:Ddx50 APN 10 62647183 missense probably benign
IGL02677:Ddx50 APN 10 62616293 missense unknown
IGL03169:Ddx50 APN 10 62621387 critical splice donor site probably null
IGL03372:Ddx50 APN 10 62643330 missense probably benign 0.11
K7371:Ddx50 UTSW 10 62621510 start codon destroyed probably null
R0123:Ddx50 UTSW 10 62621377 splice site probably benign
R0134:Ddx50 UTSW 10 62621377 splice site probably benign
R0318:Ddx50 UTSW 10 62642837 missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62616249 missense unknown
R1244:Ddx50 UTSW 10 62642924 missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62647068 missense possibly damaging 0.45
R2005:Ddx50 UTSW 10 62640464 missense probably benign 0.10
R2924:Ddx50 UTSW 10 62627594 missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62642946 missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62640770 nonsense probably null
R4917:Ddx50 UTSW 10 62627671 nonsense probably null
R4918:Ddx50 UTSW 10 62627671 nonsense probably null
R4951:Ddx50 UTSW 10 62634120 missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62642853 missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62640861 missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62647030 missense probably benign
R5648:Ddx50 UTSW 10 62616270 missense unknown
R5899:Ddx50 UTSW 10 62640817 nonsense probably null
R6127:Ddx50 UTSW 10 62621563 unclassified probably null
R6244:Ddx50 UTSW 10 62621566 unclassified probably null
X0026:Ddx50 UTSW 10 62625191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGAAGAGGTACCTCAAAC -3'
(R):5'- AGTCCAAAGCGTACTCTGAATCTTC -3'

Sequencing Primer
(F):5'- GAGGTACCTCAAACTTGAATTTAGC -3'
(R):5'- CAAAGCGTACTCTGAATCTTCTTTTG -3'
Posted On2015-04-02