Incidental Mutation 'R3803:Larp4b'
ID274441
Institutional Source Beutler Lab
Gene Symbol Larp4b
Ensembl Gene ENSMUSG00000033499
Gene NameLa ribonucleoprotein domain family, member 4B
SynonymsLarp5, D13Wsu64e
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R3803 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9093881-9174451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9158554 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 414 (N414K)
Ref Sequence ENSEMBL: ENSMUSP00000139578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091829] [ENSMUST00000188211] [ENSMUST00000188939]
Predicted Effect probably benign
Transcript: ENSMUST00000091829
SMART Domains Protein: ENSMUSP00000089437
Gene: ENSMUSG00000033499

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188211
AA Change: N414K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140993
Gene: ENSMUSG00000033499
AA Change: N414K

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188939
AA Change: N414K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139578
Gene: ENSMUSG00000033499
AA Change: N414K

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved protein family implicated in RNA metabolism and translation. Members of this family are characterized by the presence of an La motif, which is often located adjacent to one or more RNA recognition motifs (RRM). Together, the two motifs constitute the functional region of the protein and enable its interaction with the RNA substrate. This protein family is divided into five sub-families: the genuine La proteins and four La-related protein (LARP) sub-families. The protein encoded by this gene belongs to LARP sub-family 4. It is a cytoplasmic protein that may play a stimulatory role in translation. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Larp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Larp4b APN 13 9158124 missense probably damaging 0.99
IGL02519:Larp4b APN 13 9158580 missense probably benign 0.04
IGL02609:Larp4b APN 13 9170680 missense probably damaging 1.00
R0116:Larp4b UTSW 13 9170688 missense probably damaging 1.00
R0390:Larp4b UTSW 13 9158107 intron probably null
R0585:Larp4b UTSW 13 9147493 missense probably damaging 1.00
R0585:Larp4b UTSW 13 9170701 missense probably benign 0.08
R0751:Larp4b UTSW 13 9166309 splice site probably benign
R1184:Larp4b UTSW 13 9166309 splice site probably benign
R1202:Larp4b UTSW 13 9166326 missense possibly damaging 0.84
R1525:Larp4b UTSW 13 9145450 missense probably damaging 1.00
R1599:Larp4b UTSW 13 9122150 missense probably damaging 1.00
R1637:Larp4b UTSW 13 9151097 missense probably benign 0.12
R1833:Larp4b UTSW 13 9151199 missense possibly damaging 0.89
R1852:Larp4b UTSW 13 9137303 critical splice donor site probably null
R1962:Larp4b UTSW 13 9136842 missense probably benign
R2359:Larp4b UTSW 13 9158163 missense probably damaging 0.97
R2973:Larp4b UTSW 13 9166311 splice site probably benign
R4810:Larp4b UTSW 13 9158591 missense probably benign
R4828:Larp4b UTSW 13 9170898 missense probably damaging 1.00
R5135:Larp4b UTSW 13 9170737 missense probably damaging 1.00
R5250:Larp4b UTSW 13 9170977 utr 3 prime probably benign
R5259:Larp4b UTSW 13 9158184 missense probably damaging 0.98
R5379:Larp4b UTSW 13 9136909 missense probably benign 0.17
R5436:Larp4b UTSW 13 9168900 missense possibly damaging 0.93
R5616:Larp4b UTSW 13 9158659 missense probably damaging 0.98
R5774:Larp4b UTSW 13 9170643 splice site probably null
R5818:Larp4b UTSW 13 9158560 missense probably benign
R6007:Larp4b UTSW 13 9168757 missense probably benign 0.13
R6248:Larp4b UTSW 13 9158702 missense probably benign 0.01
R6452:Larp4b UTSW 13 9147467 missense probably damaging 0.98
R6501:Larp4b UTSW 13 9168793 missense probably damaging 1.00
R7324:Larp4b UTSW 13 9158580 missense probably benign 0.04
R7689:Larp4b UTSW 13 9136798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGATGCCAGCAGTGAG -3'
(R):5'- CAAGACTACTTGGCTCCACACG -3'

Sequencing Primer
(F):5'- CCAGCAGTGAGGAGGAGATTCTC -3'
(R):5'- ATCTCTCTCTTGGCATAAGCTGAAGG -3'
Posted On2015-04-02