Mutagenetix > Incidental Mutations

Incidental Mutation 'R3803:Stc1'

274447

Institutional Source

Beutler Lab

Gene Symbol

Stc1

Ensembl Gene

ENSMUSG00000014813

Gene Name

stanniocalcin 1

Synonyms

MMRRC Submission

040878-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.331) question?

Stock #

R3803 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

69029238-69041804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69038475 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 239 (I239T)

Ref Sequence

ENSEMBL: ENSMUSP00000014957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014957]

Predicted Effect

probably benign
Transcript: ENSMUST00000014957
AA Change: I239T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014957
Gene: ENSMUSG00000014813
AA Change: I239T

Domain	Start	End	E-Value	Type
Pfam:Stanniocalcin	6	206	1.6e-104	PFAM

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,508,338		probably null	Het
A2ml1	T	C	6: 128,545,070	N1263S	probably benign	Het
Alpk1	A	C	3: 127,679,837	V839G	possibly damaging	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Aox2	T	A	1: 58,289,899		probably null	Het
Aqp12	C	T	1: 93,006,366		probably benign	Het
Arhgap24	T	C	5: 102,892,442	V508A	probably damaging	Het
Arhgap9	T	A	10: 127,329,517	D598E	possibly damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Clstn1	A	G	4: 149,635,339	H437R	probably damaging	Het
Col1a1	A	G	11: 94,938,069	E79G	unknown	Het
Cspp1	C	A	1: 10,126,373	D157E	probably damaging	Het
Cyp4f16	T	C	17: 32,544,884	S217P	possibly damaging	Het
Ddx50	C	A	10: 62,639,944	V333F	probably damaging	Het
Dnaic2	A	G	11: 114,738,725	S193G	probably benign	Het
Dync2h1	A	T	9: 6,935,293	H4236Q	probably benign	Het
Emc1	T	C	4: 139,367,163	Y676H	possibly damaging	Het
Erich6	T	A	3: 58,621,332	Y499F	probably damaging	Het
Fa2h	A	G	8: 111,355,398		probably null	Het
Gli1	T	A	10: 127,338,065		probably benign	Het
Gm14403	A	G	2: 177,508,776	S172G	probably benign	Het
Grhl1	C	T	12: 24,584,919	T330M	probably damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Gstm3	G	A	3: 107,964,235	T210I	probably benign	Het
H2-Ke6	A	T	17: 34,026,467	V231E	probably damaging	Het
Helz2	A	G	2: 181,239,996	F335L	probably damaging	Het
Hr	G	A	14: 70,557,893	A322T	probably benign	Het
Iapp	A	G	6: 142,303,425	N68S	probably benign	Het
Kctd4	A	T	14: 75,963,286	L232F	probably benign	Het
Kdm5b	A	G	1: 134,615,941	I783V	probably benign	Het
Larp4b	T	A	13: 9,158,554	N414K	probably benign	Het
Ldb2	T	C	5: 44,473,394	E337G	probably benign	Het
Lgr4	A	G	2: 110,008,197	K498E	probably benign	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Luc7l3	A	T	11: 94,293,166		probably benign	Het
Ndrg2	C	A	14: 51,910,675		probably null	Het
Ndufaf3	C	A	9: 108,566,893	R12L	probably benign	Het
Nol4	A	T	18: 22,694,955	L634I	probably damaging	Het
Npr3	C	T	15: 11,895,790	A257T	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1284	A	T	2: 111,379,293	M98L	possibly damaging	Het
Olfr576	T	C	7: 102,966,021		probably null	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Pclo	C	T	5: 14,515,402	Q61*	probably null	Het
Phf19	A	G	2: 34,899,658	L350P	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Pkhd1l1	T	C	15: 44,493,135	L332P	probably benign	Het
Prpf4b	T	C	13: 34,883,682		probably benign	Het
Rgl3	A	G	9: 21,976,025	I500T	probably damaging	Het
Rgs7	T	A	1: 175,189,219	I62F	probably benign	Het
Rttn	A	G	18: 88,977,707	N205D	probably damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Scn7a	G	A	2: 66,680,246	Q1271*	probably null	Het
Skor1	A	G	9: 63,145,586	V339A	probably benign	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc5a6	T	C	5: 31,042,951	E130G	probably damaging	Het
Sorcs2	T	A	5: 36,397,806	K80N	probably benign	Het
Steap4	G	T	5: 7,976,979	R314L	probably damaging	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Trav7d-4	A	T	14: 52,770,118	K23*	probably null	Het
Ttn	A	G	2: 76,810,731	L13598P	probably damaging	Het
Vmn2r52	A	G	7: 10,173,512	S96P	probably damaging	Het
Wdr25	T	C	12: 108,898,553	V208A	probably damaging	Het
Wdr27	C	T	17: 14,918,109	V360M	probably benign	Het
Zfp54	T	C	17: 21,433,552	C103R	possibly damaging	Het
Zfp618	A	G	4: 63,133,019	E679G	probably damaging	Het
Zfp846	A	G	9: 20,594,439	I532V	probably benign	Het
Zkscan2	A	T	7: 123,495,142		probably benign	Het

Other mutations in Stc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Stc1	APN	14	69038277	missense	probably benign	0.21
IGL01918:Stc1	APN	14	69031654	splice site	probably benign
R0318:Stc1	UTSW	14	69038418	missense	probably damaging	0.98
R0322:Stc1	UTSW	14	69029409	missense	probably benign	0.08
R1699:Stc1	UTSW	14	69038327	missense	probably benign	0.00
R2005:Stc1	UTSW	14	69031647	critical splice donor site	probably null
R3801:Stc1	UTSW	14	69038475	missense	probably benign
R4184:Stc1	UTSW	14	69029385	start gained	probably benign
R5206:Stc1	UTSW	14	69031599	missense	probably damaging	1.00
R5927:Stc1	UTSW	14	69032373	missense	probably benign	0.02
R6059:Stc1	UTSW	14	69032438	missense	probably damaging	1.00
R6185:Stc1	UTSW	14	69038364	missense	probably damaging	1.00
R7722:Stc1	UTSW	14	69032280	missense	possibly damaging	0.76
R8001:Stc1	UTSW	14	69038395	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- TCAGAGACAGCCTGATGGAG -3'
(R):5'- AATGCTGTCATTGCAGAATGTTGG -3'

Sequencing Primer
(F):5'- CTGATGGAGAAGATCGGGCCC -3'
(R):5'- GATTATGGAAGCCTAGTTTCATGC -3'

Posted On

2015-04-02