Incidental Mutation 'R3803:Stc1'
ID 274447
Institutional Source Beutler Lab
Gene Symbol Stc1
Ensembl Gene ENSMUSG00000014813
Gene Name stanniocalcin 1
Synonyms
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock # R3803 (G1)
Quality Score 222
Status Validated
Chromosome 14
Chromosomal Location 69029238-69041804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69038475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 239 (I239T)
Ref Sequence ENSEMBL: ENSMUSP00000014957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014957]
AlphaFold O55183
Predicted Effect probably benign
Transcript: ENSMUST00000014957
AA Change: I239T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014957
Gene: ENSMUSG00000014813
AA Change: I239T

DomainStartEndE-ValueType
Pfam:Stanniocalcin 6 206 1.6e-104 PFAM
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Stc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Stc1 APN 14 69038277 missense probably benign 0.21
IGL01918:Stc1 APN 14 69031654 splice site probably benign
R0318:Stc1 UTSW 14 69038418 missense probably damaging 0.98
R0322:Stc1 UTSW 14 69029409 missense probably benign 0.08
R1699:Stc1 UTSW 14 69038327 missense probably benign 0.00
R2005:Stc1 UTSW 14 69031647 critical splice donor site probably null
R3801:Stc1 UTSW 14 69038475 missense probably benign
R4184:Stc1 UTSW 14 69029385 start gained probably benign
R5206:Stc1 UTSW 14 69031599 missense probably damaging 1.00
R5927:Stc1 UTSW 14 69032373 missense probably benign 0.02
R6059:Stc1 UTSW 14 69032438 missense probably damaging 1.00
R6185:Stc1 UTSW 14 69038364 missense probably damaging 1.00
R7722:Stc1 UTSW 14 69032280 missense possibly damaging 0.76
R8001:Stc1 UTSW 14 69038395 missense probably benign 0.34
R8870:Stc1 UTSW 14 69038376 missense probably benign 0.01
R8944:Stc1 UTSW 14 69032435 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TCAGAGACAGCCTGATGGAG -3'
(R):5'- AATGCTGTCATTGCAGAATGTTGG -3'

Sequencing Primer
(F):5'- CTGATGGAGAAGATCGGGCCC -3'
(R):5'- GATTATGGAAGCCTAGTTTCATGC -3'
Posted On 2015-04-02