Mutagenetix > Incidental Mutations

Incidental Mutation 'R3803:Btaf1'

274460

Institutional Source

Beutler Lab

Gene Symbol

Btaf1

Ensembl Gene

ENSMUSG00000040565

Gene Name

B-TFIID TATA-box binding protein associated factor 1

Synonyms

E430027O22Rik

MMRRC Submission

040878-MU

Accession Numbers

Genbank: NM_001080706

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R3803 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36926079-37012752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36986548 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 840 (T840S)

Ref Sequence

ENSEMBL: ENSMUSP00000097093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099494]

Predicted Effect

probably benign
Transcript: ENSMUST00000099494
AA Change: T840S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: T840S

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
low complexity region	143	152	N/A	INTRINSIC
PDB:3OC3\|B	276	414	3e-6	PDB
low complexity region	438	454	N/A	INTRINSIC
Pfam:DUF3535	585	1051	1.1e-133	PFAM
low complexity region	1099	1110	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
DEXDc	1261	1469	3.02e-30	SMART
low complexity region	1630	1641	N/A	INTRINSIC
HELICc	1657	1743	2.22e-19	SMART

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]

Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,508,338		probably null	Het
A2ml1	T	C	6: 128,545,070	N1263S	probably benign	Het
Alpk1	A	C	3: 127,679,837	V839G	possibly damaging	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Aox2	T	A	1: 58,289,899		probably null	Het
Aqp12	C	T	1: 93,006,366		probably benign	Het
Arhgap24	T	C	5: 102,892,442	V508A	probably damaging	Het
Arhgap9	T	A	10: 127,329,517	D598E	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Clstn1	A	G	4: 149,635,339	H437R	probably damaging	Het
Col1a1	A	G	11: 94,938,069	E79G	unknown	Het
Cspp1	C	A	1: 10,126,373	D157E	probably damaging	Het
Cyp4f16	T	C	17: 32,544,884	S217P	possibly damaging	Het
Ddx50	C	A	10: 62,639,944	V333F	probably damaging	Het
Dnaic2	A	G	11: 114,738,725	S193G	probably benign	Het
Dync2h1	A	T	9: 6,935,293	H4236Q	probably benign	Het
Emc1	T	C	4: 139,367,163	Y676H	possibly damaging	Het
Erich6	T	A	3: 58,621,332	Y499F	probably damaging	Het
Fa2h	A	G	8: 111,355,398		probably null	Het
Gli1	T	A	10: 127,338,065		probably benign	Het
Gm14403	A	G	2: 177,508,776	S172G	probably benign	Het
Grhl1	C	T	12: 24,584,919	T330M	probably damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Gstm3	G	A	3: 107,964,235	T210I	probably benign	Het
H2-Ke6	A	T	17: 34,026,467	V231E	probably damaging	Het
Helz2	A	G	2: 181,239,996	F335L	probably damaging	Het
Hr	G	A	14: 70,557,893	A322T	probably benign	Het
Iapp	A	G	6: 142,303,425	N68S	probably benign	Het
Kctd4	A	T	14: 75,963,286	L232F	probably benign	Het
Kdm5b	A	G	1: 134,615,941	I783V	probably benign	Het
Larp4b	T	A	13: 9,158,554	N414K	probably benign	Het
Ldb2	T	C	5: 44,473,394	E337G	probably benign	Het
Lgr4	A	G	2: 110,008,197	K498E	probably benign	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Luc7l3	A	T	11: 94,293,166		probably benign	Het
Ndrg2	C	A	14: 51,910,675		probably null	Het
Ndufaf3	C	A	9: 108,566,893	R12L	probably benign	Het
Nol4	A	T	18: 22,694,955	L634I	probably damaging	Het
Npr3	C	T	15: 11,895,790	A257T	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1284	A	T	2: 111,379,293	M98L	possibly damaging	Het
Olfr576	T	C	7: 102,966,021		probably null	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Pclo	C	T	5: 14,515,402	Q61*	probably null	Het
Phf19	A	G	2: 34,899,658	L350P	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Pkhd1l1	T	C	15: 44,493,135	L332P	probably benign	Het
Prpf4b	T	C	13: 34,883,682		probably benign	Het
Rgl3	A	G	9: 21,976,025	I500T	probably damaging	Het
Rgs7	T	A	1: 175,189,219	I62F	probably benign	Het
Rttn	A	G	18: 88,977,707	N205D	probably damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Scn7a	G	A	2: 66,680,246	Q1271*	probably null	Het
Skor1	A	G	9: 63,145,586	V339A	probably benign	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc5a6	T	C	5: 31,042,951	E130G	probably damaging	Het
Sorcs2	T	A	5: 36,397,806	K80N	probably benign	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Steap4	G	T	5: 7,976,979	R314L	probably damaging	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Trav7d-4	A	T	14: 52,770,118	K23*	probably null	Het
Ttn	A	G	2: 76,810,731	L13598P	probably damaging	Het
Vmn2r52	A	G	7: 10,173,512	S96P	probably damaging	Het
Wdr25	T	C	12: 108,898,553	V208A	probably damaging	Het
Wdr27	C	T	17: 14,918,109	V360M	probably benign	Het
Zfp54	T	C	17: 21,433,552	C103R	possibly damaging	Het
Zfp618	A	G	4: 63,133,019	E679G	probably damaging	Het
Zfp846	A	G	9: 20,594,439	I532V	probably benign	Het
Zkscan2	A	T	7: 123,495,142		probably benign	Het

Other mutations in Btaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Btaf1	APN	19	37009702	missense	probably damaging	1.00
IGL00535:Btaf1	APN	19	36997535	missense	probably damaging	1.00
IGL00574:Btaf1	APN	19	36969930	missense	probably benign	0.00
IGL00969:Btaf1	APN	19	37011252	splice site	probably benign
IGL01325:Btaf1	APN	19	37004649	splice site	probably benign
IGL01399:Btaf1	APN	19	37000170	nonsense	probably null
IGL02024:Btaf1	APN	19	36992426	splice site	probably benign
IGL02471:Btaf1	APN	19	37000192	missense	probably damaging	0.96
IGL02664:Btaf1	APN	19	36978428	splice site	probably benign
IGL02898:Btaf1	APN	19	36969068	missense	probably benign
IGL02995:Btaf1	APN	19	36981135	splice site	probably benign
IGL03023:Btaf1	APN	19	37010015	missense	possibly damaging	0.85
IGL03188:Btaf1	APN	19	36949108	missense	possibly damaging	0.91
IGL03353:Btaf1	APN	19	36992500	missense	probably damaging	1.00
freudenberg	UTSW	19	36988173	critical splice donor site	probably null
Galanos	UTSW	19	36949102	missense	probably damaging	1.00
3-1:Btaf1	UTSW	19	37010078	missense	probably damaging	1.00
R0013:Btaf1	UTSW	19	36958373	missense	probably benign
R0048:Btaf1	UTSW	19	37003524	missense	probably benign	0.01
R0117:Btaf1	UTSW	19	36969968	missense	probably benign	0.06
R0207:Btaf1	UTSW	19	37009648	nonsense	probably null
R0310:Btaf1	UTSW	19	37004534	missense	probably damaging	0.96
R0377:Btaf1	UTSW	19	36989002	missense	probably benign
R0419:Btaf1	UTSW	19	36945229	missense	probably damaging	0.99
R0440:Btaf1	UTSW	19	36986653	missense	probably damaging	0.99
R0532:Btaf1	UTSW	19	36951186	splice site	probably benign
R0612:Btaf1	UTSW	19	36969137	missense	probably damaging	0.99
R0731:Btaf1	UTSW	19	36997495	splice site	probably null
R0780:Btaf1	UTSW	19	36988922	missense	probably damaging	0.99
R0919:Btaf1	UTSW	19	36990743	missense	probably benign	0.03
R1104:Btaf1	UTSW	19	37004602	missense	probably damaging	1.00
R1263:Btaf1	UTSW	19	36956524	missense	probably benign	0.10
R1325:Btaf1	UTSW	19	36969162	missense	possibly damaging	0.68
R1447:Btaf1	UTSW	19	36992454	missense	probably benign	0.00
R1554:Btaf1	UTSW	19	36996598	missense	probably benign	0.02
R1649:Btaf1	UTSW	19	36981722	missense	probably benign
R1715:Btaf1	UTSW	19	36969121	missense	probably damaging	0.99
R1733:Btaf1	UTSW	19	36994962	missense	probably benign
R1764:Btaf1	UTSW	19	36951118	missense	probably benign	0.12
R1874:Btaf1	UTSW	19	36980583	missense	probably benign
R1911:Btaf1	UTSW	19	36986630	missense	probably benign
R1933:Btaf1	UTSW	19	36972957	missense	probably damaging	1.00
R2080:Btaf1	UTSW	19	36951148	missense	probably benign	0.09
R2483:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R2510:Btaf1	UTSW	19	37002445	missense	probably benign	0.08
R3623:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3624:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3801:Btaf1	UTSW	19	36986548	missense	probably benign
R3801:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3802:Btaf1	UTSW	19	36986548	missense	probably benign
R3802:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3803:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R4077:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4079:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4133:Btaf1	UTSW	19	36961738	missense	probably benign	0.00
R4673:Btaf1	UTSW	19	36978372	missense	probably benign	0.00
R4731:Btaf1	UTSW	19	36981078	missense	probably benign	0.03
R4796:Btaf1	UTSW	19	36956428	missense	possibly damaging	0.95
R4824:Btaf1	UTSW	19	36981048	missense	possibly damaging	0.84
R4835:Btaf1	UTSW	19	37002458	missense	probably benign	0.00
R4837:Btaf1	UTSW	19	36966785	missense	probably benign
R4925:Btaf1	UTSW	19	37011333	missense	probably benign
R4968:Btaf1	UTSW	19	36969951	missense	probably null	0.71
R4976:Btaf1	UTSW	19	36986579	missense	probably benign
R5001:Btaf1	UTSW	19	36986652	missense	possibly damaging	0.90
R5037:Btaf1	UTSW	19	37003531	missense	probably damaging	1.00
R5039:Btaf1	UTSW	19	36990762	missense	probably benign
R5211:Btaf1	UTSW	19	36996562	missense	probably benign	0.32
R5422:Btaf1	UTSW	19	36951107	missense	probably benign	0.09
R5429:Btaf1	UTSW	19	36994857	missense	possibly damaging	0.58
R5530:Btaf1	UTSW	19	36990775	missense	possibly damaging	0.85
R5582:Btaf1	UTSW	19	36988173	critical splice donor site	probably null
R5654:Btaf1	UTSW	19	36983615	missense	probably benign	0.35
R5744:Btaf1	UTSW	19	37004490	missense	probably benign	0.02
R6082:Btaf1	UTSW	19	36983542	missense	probably damaging	1.00
R6243:Btaf1	UTSW	19	36981120	missense	probably benign	0.02
R6291:Btaf1	UTSW	19	36973008	missense	probably benign	0.00
R6502:Btaf1	UTSW	19	36983617	missense	probably benign
R7034:Btaf1	UTSW	19	37004469	missense	probably benign
R7036:Btaf1	UTSW	19	37004469	missense	probably benign
R7085:Btaf1	UTSW	19	36972918	missense	probably benign
R7097:Btaf1	UTSW	19	36949102	missense	probably damaging	1.00
R7248:Btaf1	UTSW	19	36945314	missense	possibly damaging	0.54
R7386:Btaf1	UTSW	19	36958382	missense	probably benign	0.02
R7402:Btaf1	UTSW	19	37003515	missense	probably damaging	1.00
R7452:Btaf1	UTSW	19	36969127	missense	probably damaging	1.00
R7493:Btaf1	UTSW	19	37009605	missense	probably damaging	1.00
R7513:Btaf1	UTSW	19	36978403	missense	probably benign	0.30
R7888:Btaf1	UTSW	19	36965636	missense	probably benign	0.10
R7944:Btaf1	UTSW	19	36949165	missense	probably benign
R8062:Btaf1	UTSW	19	36992465	missense	probably benign	0.00
R8559:Btaf1	UTSW	19	36986873	missense	probably benign	0.00
R8793:Btaf1	UTSW	19	36981029	missense	probably benign	0.21
W0251:Btaf1	UTSW	19	37003504	missense	probably damaging	1.00
X0027:Btaf1	UTSW	19	36949096	nonsense	probably null
Z1088:Btaf1	UTSW	19	36986618	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGAAACAGAAAACTGCCACTTAGG -3'
(R):5'- CATGGTGTCCTTGTTGTACAC -3'

Sequencing Primer
(F):5'- ACTGCCACTTAGGAGTTTTAGAG -3'
(R):5'- AGCTTAGCTATGTACTGAGCAGC -3'

Posted On

2015-04-02