Incidental Mutation 'R3803:Pak3'
ID274462
Institutional Source Beutler Lab
Gene Symbol Pak3
Ensembl Gene ENSMUSG00000031284
Gene Namep21 (RAC1) activated kinase 3
SynonymsPAK-3
MMRRC Submission 040878-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R3803 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location143518591-143797796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143709731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 87 (V87I)
Ref Sequence ENSEMBL: ENSMUSP00000118716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033640] [ENSMUST00000112863] [ENSMUST00000112864] [ENSMUST00000112865] [ENSMUST00000112868] [ENSMUST00000134402] [ENSMUST00000155215] [ENSMUST00000156449] [ENSMUST00000172330]
Predicted Effect probably benign
Transcript: ENSMUST00000033640
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033640
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112863
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108484
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112864
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108485
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112865
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108486
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112868
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108489
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134402
AA Change: V87I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119090
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 2.49e-9 SMART
Pfam:PBD 124 163 2e-9 PFAM
low complexity region 208 225 N/A INTRINSIC
Pfam:Pkinase 304 366 4e-10 PFAM
Pfam:Pkinase_Tyr 304 366 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155215
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118549
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156449
AA Change: V87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118716
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172330
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126562
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Meta Mutation Damage Score 0.1486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of non-syndromic mental retardation X-linked type 30 (MRX30), also called X-linked mental retardation type 47 (MRX47). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for one knock-out allele display a selective impairment in hippocampal late-phase long-term potentiation, and deficits in learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,508,338 probably null Het
A2ml1 T C 6: 128,545,070 N1263S probably benign Het
Alpk1 A C 3: 127,679,837 V839G possibly damaging Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Aox2 T A 1: 58,289,899 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Arhgap24 T C 5: 102,892,442 V508A probably damaging Het
Arhgap9 T A 10: 127,329,517 D598E possibly damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Clstn1 A G 4: 149,635,339 H437R probably damaging Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Cspp1 C A 1: 10,126,373 D157E probably damaging Het
Cyp4f16 T C 17: 32,544,884 S217P possibly damaging Het
Ddx50 C A 10: 62,639,944 V333F probably damaging Het
Dnaic2 A G 11: 114,738,725 S193G probably benign Het
Dync2h1 A T 9: 6,935,293 H4236Q probably benign Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Erich6 T A 3: 58,621,332 Y499F probably damaging Het
Fa2h A G 8: 111,355,398 probably null Het
Gli1 T A 10: 127,338,065 probably benign Het
Gm14403 A G 2: 177,508,776 S172G probably benign Het
Grhl1 C T 12: 24,584,919 T330M probably damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Helz2 A G 2: 181,239,996 F335L probably damaging Het
Hr G A 14: 70,557,893 A322T probably benign Het
Iapp A G 6: 142,303,425 N68S probably benign Het
Kctd4 A T 14: 75,963,286 L232F probably benign Het
Kdm5b A G 1: 134,615,941 I783V probably benign Het
Larp4b T A 13: 9,158,554 N414K probably benign Het
Ldb2 T C 5: 44,473,394 E337G probably benign Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Luc7l3 A T 11: 94,293,166 probably benign Het
Ndrg2 C A 14: 51,910,675 probably null Het
Ndufaf3 C A 9: 108,566,893 R12L probably benign Het
Nol4 A T 18: 22,694,955 L634I probably damaging Het
Npr3 C T 15: 11,895,790 A257T probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1284 A T 2: 111,379,293 M98L possibly damaging Het
Olfr576 T C 7: 102,966,021 probably null Het
Pclo C T 5: 14,515,402 Q61* probably null Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Pkhd1l1 T C 15: 44,493,135 L332P probably benign Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rgl3 A G 9: 21,976,025 I500T probably damaging Het
Rgs7 T A 1: 175,189,219 I62F probably benign Het
Rttn A G 18: 88,977,707 N205D probably damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Scn7a G A 2: 66,680,246 Q1271* probably null Het
Skor1 A G 9: 63,145,586 V339A probably benign Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc5a6 T C 5: 31,042,951 E130G probably damaging Het
Sorcs2 T A 5: 36,397,806 K80N probably benign Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Steap4 G T 5: 7,976,979 R314L probably damaging Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Trav7d-4 A T 14: 52,770,118 K23* probably null Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn2r52 A G 7: 10,173,512 S96P probably damaging Het
Wdr25 T C 12: 108,898,553 V208A probably damaging Het
Wdr27 C T 17: 14,918,109 V360M probably benign Het
Zfp54 T C 17: 21,433,552 C103R possibly damaging Het
Zfp618 A G 4: 63,133,019 E679G probably damaging Het
Zfp846 A G 9: 20,594,439 I532V probably benign Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Pak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Pak3 APN X 143789333 missense probably damaging 1.00
R0464:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0583:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0586:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0587:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0781:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0908:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1029:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1917:Pak3 UTSW X 143791302 missense possibly damaging 0.94
R2918:Pak3 UTSW X 143764976 missense probably damaging 1.00
R3801:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3802:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3804:Pak3 UTSW X 143709731 missense probably damaging 1.00
R4326:Pak3 UTSW X 143733209 splice site probably null
R4328:Pak3 UTSW X 143733209 splice site probably null
R4329:Pak3 UTSW X 143733209 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCATGTACTTGTCAGTAAGG -3'
(R):5'- TTCAGGCAGGGTCTCCTTAG -3'

Sequencing Primer
(F):5'- TGTACATACCAGAAAACGATGAGTC -3'
(R):5'- GGCAGGGTCTCCTTAGCATAACTAC -3'
Posted On2015-04-02