Incidental Mutation 'R3804:Rxra'
ID274470
Institutional Source Beutler Lab
Gene Symbol Rxra
Ensembl Gene ENSMUSG00000015846
Gene Nameretinoid X receptor alpha
SynonymsRXRalpha1, RXR alpha 1, 9530071D11Rik
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3804 (G1)
Quality Score211
Status Validated
Chromosome2
Chromosomal Location27676440-27762957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27756260 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 374 (C374R)
Ref Sequence ENSEMBL: ENSMUSP00000133044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000166775]
PDB Structure
CRYSTAL STRUCTURE OF A HETERODIMERIC COMPLEX OF RAR AND RXR LIGAND-BINDING DOMAINS [X-RAY DIFFRACTION]
Crystal Structure of the RARbeta/RXRalpha Ligand Binding Domain Heterodimer in Complex with 9-cis Retinoic Acid and a Fragment of the TRAP220 Coactivator [X-RAY DIFFRACTION]
Crystal structure of a mixed agonist-bound RAR-alpha and antagonist-bound RXR-alpha heterodimer ligand binding domains [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000077257
AA Change: C374R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: C374R

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 18 132 4.2e-42 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100251
AA Change: C346R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: C346R

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113934
AA Change: C346R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: C346R

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166775
AA Change: C374R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: C374R

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 17 132 6.5e-41 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Meta Mutation Damage Score 0.9751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Rxra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Rxra APN 2 27754241 missense probably damaging 1.00
IGL03006:Rxra APN 2 27759645 missense probably damaging 1.00
pinkie UTSW 2 27752334 missense probably damaging 0.98
R0265:Rxra UTSW 2 27752430 missense probably damaging 1.00
R0578:Rxra UTSW 2 27759570 missense probably damaging 1.00
R1555:Rxra UTSW 2 27748678 missense probably benign 0.00
R1775:Rxra UTSW 2 27756244 missense probably damaging 1.00
R3725:Rxra UTSW 2 27754277 missense probably damaging 1.00
R3756:Rxra UTSW 2 27741911 missense probably damaging 1.00
R3965:Rxra UTSW 2 27752306 splice site probably benign
R4490:Rxra UTSW 2 27741195 missense probably damaging 0.99
R4898:Rxra UTSW 2 27741183 missense probably damaging 1.00
R5154:Rxra UTSW 2 27757868 critical splice donor site probably null
R5651:Rxra UTSW 2 27737341 missense probably benign 0.25
R6880:Rxra UTSW 2 27748656 missense possibly damaging 0.64
R6913:Rxra UTSW 2 27741174 missense probably damaging 1.00
R7404:Rxra UTSW 2 27741854 missense probably damaging 0.99
R8324:Rxra UTSW 2 27741183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTTTCAGTCATTCTCGG -3'
(R):5'- CTAATGTCAAGTGCCTACTCTGG -3'

Sequencing Primer
(F):5'- ATTCTCGGTCCGTCCTGGG -3'
(R):5'- ATAGAGTGCCACTTGAGCCTC -3'
Posted On2015-04-02