Incidental Mutation 'R3804:Dgkz'
ID274474
Institutional Source Beutler Lab
Gene Symbol Dgkz
Ensembl Gene ENSMUSG00000040479
Gene Namediacylglycerol kinase zeta
SynonymsE130307B02Rik, mDGK[z]
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3804 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91932824-91975864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91939630 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 563 (R563L)
Ref Sequence ENSEMBL: ENSMUSP00000106934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000128152] [ENSMUST00000142090] [ENSMUST00000142231]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
AA Change: R369L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479
AA Change: R369L

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099709
AA Change: R386L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479
AA Change: R386L

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111303
AA Change: R563L

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479
AA Change: R563L

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126473
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130023
Predicted Effect probably benign
Transcript: ENSMUST00000142090
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Meta Mutation Damage Score 0.1257 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
PHENOTYPE: The T cell response is enhanced in homozygous mutant mice, which showed a robust response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Dgkz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Dgkz APN 2 91935865 missense probably benign 0.00
IGL01995:Dgkz APN 2 91934050 splice site probably benign
IGL02247:Dgkz APN 2 91937460 missense probably benign 0.00
IGL02573:Dgkz APN 2 91934197 missense probably damaging 0.98
IGL02627:Dgkz APN 2 91938710 splice site probably benign
IGL02903:Dgkz APN 2 91939962 missense possibly damaging 0.45
IGL03106:Dgkz APN 2 91940859 missense probably damaging 0.99
R0103:Dgkz UTSW 2 91934205 missense probably benign
R0312:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R0761:Dgkz UTSW 2 91945351 missense probably benign 0.00
R0839:Dgkz UTSW 2 91935111 missense probably benign 0.00
R1162:Dgkz UTSW 2 91944444 missense probably damaging 1.00
R1223:Dgkz UTSW 2 91939315 splice site probably benign
R1539:Dgkz UTSW 2 91938060 missense probably damaging 1.00
R1934:Dgkz UTSW 2 91937104 missense possibly damaging 0.92
R1936:Dgkz UTSW 2 91937978 missense possibly damaging 0.94
R3438:Dgkz UTSW 2 91934050 splice site probably benign
R4675:Dgkz UTSW 2 91938346 nonsense probably null
R4731:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4732:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4733:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4901:Dgkz UTSW 2 91936731 missense probably benign
R4972:Dgkz UTSW 2 91945702 missense probably benign 0.00
R5027:Dgkz UTSW 2 91945543 missense probably benign 0.02
R5128:Dgkz UTSW 2 91942683 missense probably damaging 1.00
R5408:Dgkz UTSW 2 91935823 missense possibly damaging 0.91
R5494:Dgkz UTSW 2 91941049 splice site probably null
R5728:Dgkz UTSW 2 91945787 missense possibly damaging 0.93
R5813:Dgkz UTSW 2 91939388 missense possibly damaging 0.50
R6025:Dgkz UTSW 2 91945910 missense possibly damaging 0.75
R6043:Dgkz UTSW 2 91935889 missense probably benign 0.03
R6328:Dgkz UTSW 2 91942635 missense probably benign 0.04
R6335:Dgkz UTSW 2 91944379 missense probably benign 0.16
R7381:Dgkz UTSW 2 91944835 missense probably benign 0.02
R7541:Dgkz UTSW 2 91942675 missense probably damaging 1.00
R7560:Dgkz UTSW 2 91942815 unclassified probably benign
R7608:Dgkz UTSW 2 91934054 critical splice donor site probably null
R7624:Dgkz UTSW 2 91942674 missense probably damaging 1.00
R7709:Dgkz UTSW 2 91937059 missense probably benign 0.02
R8183:Dgkz UTSW 2 91939592 missense probably damaging 1.00
R8233:Dgkz UTSW 2 91939649 missense probably damaging 1.00
RF001:Dgkz UTSW 2 91939941 missense possibly damaging 0.83
X0002:Dgkz UTSW 2 91936562 missense probably damaging 0.97
X0021:Dgkz UTSW 2 91937119 missense possibly damaging 0.91
Z1177:Dgkz UTSW 2 91942334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGCTGTACCACATTCC -3'
(R):5'- GCTGGAAATGTACCGCAAAGTAC -3'

Sequencing Primer
(F):5'- AGGATCTTTGACACAGGCTC -3'
(R):5'- ACATAATTTGAGGATTCTGGCTTGC -3'
Posted On2015-04-02