Incidental Mutation 'R3804:Ccdc39'
ID274478
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Namecoiled-coil domain containing 39
Synonymsb2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R3804 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location33812362-33844310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33819895 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 596 (M596K)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222]
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: M596K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: M596K

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200551
Meta Mutation Damage Score 0.2609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33832568 missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33816958 unclassified probably benign
IGL02426:Ccdc39 APN 3 33825398 missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33825494 missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33830118 missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33837843 missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33819839 missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33844125 missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33815485 missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33821412 missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33839145 missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33819896 missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33815501 missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33821432 missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33836733 missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33841178 missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33815484 missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33837838 missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33814497 missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33825479 missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33837882 missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33826522 missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33819806 critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33813078 missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33839093 splice site probably null
R5236:Ccdc39 UTSW 3 33830102 missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33825550 missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33816937 missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33826561 missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33841192 splice site probably null
R6375:Ccdc39 UTSW 3 33814367 missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33837959 missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33830093 missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33819868 missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33814471 missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33830105 missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33832676 missense possibly damaging 0.55
R7645:Ccdc39 UTSW 3 33825169 splice site probably null
R7695:Ccdc39 UTSW 3 33814519 missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33832617 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCAGGAAACAGGGAGCTCTC -3'
(R):5'- GCAGATGTCACATAGTGGTCTAATTG -3'

Sequencing Primer
(F):5'- AGGGAGCTCTCCTCACAC -3'
(R):5'- TCATGTTTGACTTTTGTTGCAATAG -3'
Posted On2015-04-02