Incidental Mutation 'R3804:Olfr481'
ID274496
Institutional Source Beutler Lab
Gene Symbol Olfr481
Ensembl Gene ENSMUSG00000054236
Gene Nameolfactory receptor 481
SynonymsMOR204-39, GA_x6K02T2PBJ9-10409785-10410723, MOR204-2
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3804 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108079855-108085824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108081171 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 126 (I126F)
Ref Sequence ENSEMBL: ENSMUSP00000151152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067143] [ENSMUST00000213601]
Predicted Effect probably damaging
Transcript: ENSMUST00000067143
AA Change: I126F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063555
Gene: ENSMUSG00000054236
AA Change: I126F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.5e-51 PFAM
Pfam:7tm_1 41 290 1.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210338
Predicted Effect probably damaging
Transcript: ENSMUST00000213601
AA Change: I126F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Olfr481
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Olfr481 APN 7 108081204 missense probably benign 0.18
IGL01570:Olfr481 APN 7 108081273 missense probably benign 0.38
IGL02619:Olfr481 APN 7 108081742 utr 3 prime probably benign
IGL03175:Olfr481 APN 7 108081718 missense probably benign
R0401:Olfr481 UTSW 7 108080872 missense possibly damaging 0.81
R0932:Olfr481 UTSW 7 108081520 missense probably damaging 1.00
R1679:Olfr481 UTSW 7 108081652 missense probably damaging 1.00
R2189:Olfr481 UTSW 7 108081036 missense possibly damaging 0.47
R4532:Olfr481 UTSW 7 108081549 missense probably benign 0.18
R4932:Olfr481 UTSW 7 108081574 missense probably damaging 0.99
R5630:Olfr481 UTSW 7 108081116 missense probably benign 0.05
R6155:Olfr481 UTSW 7 108081286 missense probably benign 0.00
R6523:Olfr481 UTSW 7 108081555 missense probably benign 0.34
R6987:Olfr481 UTSW 7 108081131 nonsense probably null
R7378:Olfr481 UTSW 7 108081192 missense not run
R7609:Olfr481 UTSW 7 108081546 missense probably damaging 0.99
R8293:Olfr481 UTSW 7 108081062 missense probably benign 0.00
V8831:Olfr481 UTSW 7 108081535 missense probably benign 0.24
Z1177:Olfr481 UTSW 7 108081072 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGCCATCTAGCCTTTGTGG -3'
(R):5'- TTCAGCAATATAAGCATGGCCAC -3'

Sequencing Primer
(F):5'- TGGACATTGGCTACTCCACATCAG -3'
(R):5'- GCATGGCCACAAGACAGTTTC -3'
Posted On2015-04-02